SubtiBank SubtiBank
relA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

relA

GTP pyrophosphokinase (stringent response)
locus
BSU27600
pI
6.96
mw
84.65 kDa
protein length
734 aa Sequence Blast
gene length
2205 bp Sequence Blast
function
synthesis and degradation of (p)ppGpp, triggering the stringent response
product
GTP pyrophosphokinase
essential
no
ec
2.7.6.5
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.3|Metabolism of signalling nucleotides]
  • Gene

    Coordinates
    2,820,529 → 2,822,733

    Phenotypes of a mutant

  • requirement for valine [Pubmed|24163341]
  • a ''[gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|relA] [gene|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA] [gene|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|sasB]'' triple mutant requires branched chain amino acids, methionine and threonine for growth, the requirement can be suppressed by reduced expression of ''[gene|AB3D18228DB6819B0C81BC7A8BB3408A4F75DC0C|guaB]'' or inactivation of ''[gene|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]'' [Pubmed|24163341]
  • a ''[gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|relA] [gene|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA] [gene|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|sasB]'' triple mutant acquires suppressor mutations in ''[gene|AC67305E4C165CC1D785E49B7CD8335346134376|guaA], [gene|AB3D18228DB6819B0C81BC7A8BB3408A4F75DC0C|guaB], [gene|1BC994DE60A7BB35DEDD7154581A396D29AA94A7|gmk]'' or inactivation of ''[gene|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]'' [Pubmed|24682323,24163341]
  • mutation in ''[gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|relA]'' results in increased motility and chaining [Pubmed|25331430]
  • ''[gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|relA]'' mutation increases flagellin production via elevated [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD] level [Pubmed|25331430]
  • The protein

    Catalyzed reaction/ biological activity

  • ATP GTP = AMP guanosine 3'-diphosphate 5'-triphosphate (according to Swiss-Prot)
  • Protein family

  • relA/spoT family (according to Swiss-Prot)
  • [SW|Domains]

  • N-terminal ppGpp hydrolase domain ([SW|HD domain]) (aa 31 ...180) [Pubmed|24163341]
  • central ppGpp synthetase domain [Pubmed|24163341]
  • C-terminal [SW|ACT domain] (aa 654 ... 734) (according to the Interpro database)
  • Effectors of protein activity

  • the interaction with [protein|41DFEF8A6BC7E34A6681C26D92F2B08DC120A957|ComGA] inhibits the hydrolysis of ppGpp [Pubmed|25899641]
  • Structure

  • [PDB|1VJ7] (N-terminal catalytic fragment, from ''Streptococcus equisimilis'', 60% identity) [Pubmed|15066282]
  • Expression and Regulation

    Operons

    genes
    [gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|relA]-[gene|860F8A7D054BF483D43B4659732F5A6D30DACBD9|dtd]
    description
    [Pubmed|9383190]
    view in new tab

    Biological materials

    Mutant

  • ''[gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|relA]'' mutant [Pubmed|9383190] - note that ''[gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|relA]'' mutants are prone to suppressor mutations in the ''[gene|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA]'' or ''[gene|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|sasB]'' loci [Pubmed|18670626]
  • GP2066 (''[gene|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA] [gene|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|sasB] [gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|relA]::mls''), available in [SW|Jörg Stülke]'s lab
  • BKE27600 (Δ[gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|relA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGAATCACCTTTTTTAA, downstream forward: _UP4_TAAAGGGGTTAGAAAAGAGA
  • BKK27600 (Δ[gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|relA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGAATCACCTTTTTTAA, downstream forward: _UP4_TAAAGGGGTTAGAAAAGAGA
  • labs

  • [SW|Mohamed Marahiel], Marburg University, Germany [http://www.uni-marburg.de/fb15/fachgebiete/bio/marahiel?language_sync=1 homepage]
  • Jue D Wang, University of Wisconsin–Madison [https://www.researchgate.net/profile/Jue_Wang8 ResearchGate-Profile]
  • References

    Reviews

  • 27149325,30980074
  • Original publications

  • 25331430,9383190,10209741,24489751,19447912,13129942,12372825,12081964,11948165,12419222,23028324,24163341,24682323,25899641,15066282,27775002,27875634,31003868