SubtiBank SubtiBank
bdbD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

bdbD

thiol-disulfide oxidoreductase, required for the formation of thiol disulfide bonds in several proteins
locus
BSU33480
pI
5.09
mw
24.76 kDa
protein length
222 aa Sequence Blast
gene length
669 bp Sequence Blast
function
oxidative folding of proteins
product
thiol-disulfide oxidoreductase
essential
no
synonyms
yvgV

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.2|Chaperones/ protein folding]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,438,065 → 3,438,733

    Phenotypes of a mutant

  • loss of transformability [Pubmed|11744713]
  • sensitive to osmotic shock [Pubmed|22540663]
  • several proteins are absent from the membrane proteome of a ''[gene|A01637E1BFABA20A2923BA85A25CCD8A0D665F78|bdbC]-[gene|CED818CEF5B573A40F382157375E60C0B331F098|bdbD]'' mutant: [Pubmed|22540663]
  • the membrane proteins [protein|35E6C81BE481C3E57CF47B781580368C3AC15D83|BglP], [protein|EC287BBD7AB1EB44A33BF29144448F53D06AC6D9|TcyP], [protein|9824F9CF9C2028AF267AC43FE7FD8590E8231AB8|SipU], [protein|497C9654DC7514FF738D18E1F083299C43003A4C|LytA], and [protein|573EBCDC59BB0167F79F00D87B916843031048D8|YxaI] [Pubmed|22540663]
  • the cytoplasmic or membrane-associated proteins [protein|search|GlkX], [protein|1629A875FCCA0C0EB1C959ED31BB6B3CFA839BF9|ProA], [protein|E7741ED6F15044900BDC5F0584246469D2D4D586|PyrAA], [protein|D57DC8A53E52BC4A2EA894E3C9FD983592882918|PyrAB], [protein|40655595D0C573B4CB75FB255CBB01A6ACF1F94D|PyrH], [protein|0197A037D2AF049B295E1DA60187D4614B2BAC51|PyrE], [protein|5D0D0D2413377FCA92440334E92B5A27A5963D9E|PyrF], [protein|047CE33C0CC127DAD15D68D63843DF89F93ED3BF|DegS], [protein|D8637043C7E2291589C966E95F94DC61B1A8AB75|YbxA] [Pubmed|22540663]
  • The protein

    Catalyzed reaction/ biological activity

  • formation of thiol disulfide bonds in [protein|363C6FE07C5E56FDE6BEC6ACFBA1A5535F0F64AC|ComEC] and [protein|19D76B80386F825109C5FB4A34881D5D20F366DB|ComGC] (together with [protein|A01637E1BFABA20A2923BA85A25CCD8A0D665F78|BdbC]) [Pubmed|11744713]
  • Protein family

  • [SW|Thioredoxin family] (according to UniProt)
  • [SW|Cofactors]

  • Ca (2+) [Pubmed|19535335]
  • Structure

  • [PDB|3EU3] (reduced form), [PDB|3EU4] (oxidized form) [Pubmed|19535335]
  • [SW|Localization]

  • membrane, faced to the outer side of the membrane [Pubmed|19535335]
  • Expression and Regulation

    Operons

    genes
    [gene|CED818CEF5B573A40F382157375E60C0B331F098|bdbD]-[gene|A01637E1BFABA20A2923BA85A25CCD8A0D665F78|bdbC]
    description
    [Pubmed|11744713]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|12480901], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, [Pubmed|11744713], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|12480901]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A033 (yvgV::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/33 NBRP B. subtilis, Japan]
  • BKE33480 (Δ[gene|CED818CEF5B573A40F382157375E60C0B331F098|bdbD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTCCGACACCTCATCGTT, downstream forward: _UP4_AAAGAGCTGAAAGGGAAGTA
  • BKK33480 (Δ[gene|CED818CEF5B573A40F382157375E60C0B331F098|bdbD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTCCGACACCTCATCGTT, downstream forward: _UP4_AAAGAGCTGAAAGGGAAGTA
  • References

    Reviews

  • 25212246
  • Original publications

  • 19535335,11744713,15661011,11872755,16751195,11844773,12480901,22540663,28698374