SubtiBank SubtiBank
yyzL
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yyzL

unknown, putative pseudogene
locus
BSU_40579
pI
0.00
mw
0.00 kDa
protein length
gene length
150 bp Sequence Blast
function
unknown
product
unknown
essential
-
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    4,172,387 → 4,172,536

    Biological materials

    Mutant

  • BKE40579 (Δ[gene|CECB202A6904D9A9D1A0B3B091BD4726DF213F00|yyzL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40579 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATGTATCTGTATTGTTC, downstream forward: _UP4_ACGCCAGAAAGTCGTTACTC
  • BKK40579 (Δ[gene|CECB202A6904D9A9D1A0B3B091BD4726DF213F00|yyzL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40579 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATGTATCTGTATTGTTC, downstream forward: _UP4_ACGCCAGAAAGTCGTTACTC