SubtiBank SubtiBank
safA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

safA

morphogenetic protein associated with [protein|6698BB092E03BEF48AFD0CBF565410109CD1ABB5|SpoVID], major organizer of the inner spore coat
locus
BSU_27840
pI
5.75
mw
43.07 kDa
protein length
387 aa Sequence Blast
gene length
1164 bp Sequence Blast
function
spore coat formation
product
morphogenetic protein
essential
no
synonyms
yrbA

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.8|Not yet assigned]
  • Gene

    Coordinates
    2,844,675 → 2,845,838

    Phenotypes of a mutant

  • mis-assembly of the inner spore coat [Pubmed|22171814]
  • The protein

    [SW|Domains]

  • contains a N-acetylglucosamine-polymer-binding [SW|LysM domain] at the N-terminus [Pubmed|18430080]
  • [SW|LysM domain] (aa 2-47) (according to UniProt)
  • [SW|Localization]

  • inner spore coat [Pubmed|23202530]
  • cortex-coat interface [pubmed|29712873]
  • additional information

  • [protein|4A2B1DA38608E5A4096087BF7246D4C64C54DBE3|Tgl] cross-links [protein|CEBEC9CECCF445C40D793E61A2CD23175631A473|SafA] to other spore coat proteins [pubmed|29712873]
  • Expression and Regulation

    Operons

    genes
    [gene|CEBEC9CECCF445C40D793E61A2CD23175631A473|safA]-[gene|6EAB09018D9AF9C488E713C232CD77B63415DCE3|coxA]
    description
    [Pubmed|10438771]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|10438771], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|10438771]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A011 (yrbA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/11 NBRP B. subtilis, Japan]
  • 1S126 ( ''safA''::''erm''), [Pubmed|16751597], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S126&Search=1S126 BGSC]
  • 1S117 ( ''safA''::''spec''), [Pubmed| ], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S117&Search=1S117 BGSC]
  • BKE27840 (Δ[gene|CEBEC9CECCF445C40D793E61A2CD23175631A473|safA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACGTTTTCCCCTCCTATG, downstream forward: _UP4_TGATCGTTCGGAACGATGTA
  • BKK27840 (Δ[gene|CEBEC9CECCF445C40D793E61A2CD23175631A473|safA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACGTTTTCCCCTCCTATG, downstream forward: _UP4_TGATCGTTCGGAACGATGTA
  • labs

  • [SW|Adriano Henriques], Lisbon, Portugal [http://www.itqb.unl.pt/research/biology/microbial-development homepage]
  • [SW|Charles Moran], Emory University, NC, USA [http://www.microbiology.emory.edu/moran_c.html homepage]
  • References

    Reviews

  • 18430080,22192522,23202530
  • Original publications

  • 10438771,16950916,11222602,11325931,20451384,10714986,22171814,22262582,23811766,25259857,26187959,29712873,30168214,30455281,30958830