SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


11.87 kDa
protein length
104 aa Sequence Blast
gene length
315 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    926,429 → 926,743

    The protein


  • [PDB|1SF9]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-C316 (yfhH::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE08530 (Δ[gene|CEB1A0835C26E14E04BA99F933787C4550A96388|yfhH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGACTGTATCGTTTCT, downstream forward: _UP4_TAAAGCGTAACAGGAGGCTG
  • BKK08530 (Δ[gene|CEB1A0835C26E14E04BA99F933787C4550A96388|yfhH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGACTGTATCGTTTCT, downstream forward: _UP4_TAAAGCGTAACAGGAGGCTG
  • References

  • 22383849