SubtiBank SubtiBank
yrhF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yrhF

unknown
locus
BSU_27210
pI
6.09
mw
13.84 kDa
protein length
122 aa Sequence Blast
gene length
369 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,780,525 → 2,780,893

    Expression and Regulation

    Operons

    genes
    [gene|CEA3119463DAA65A18F891479B955235154AE402|yrhF]
    description
    [Pubmed|21815947]

    additional information

  • the mRNA is substantially stabilized upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A149 (yrhF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/149 NBRP B. subtilis, Japan]
  • BKE27210 (Δ[gene|CEA3119463DAA65A18F891479B955235154AE402|yrhF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27210 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTGATTACCCCTTCCG, downstream forward: _UP4_TAGTATATTTGTCATTGACA
  • BKK27210 (Δ[gene|CEA3119463DAA65A18F891479B955235154AE402|yrhF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27210 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTGATTACCCCTTCCG, downstream forward: _UP4_TAGTATATTTGTCATTGACA
  • References

  • 21815947