SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


13.84 kDa
protein length
122 aa Sequence Blast
gene length
369 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    2,780,525 → 2,780,893

    Expression and Regulation



    additional information

  • the mRNA is substantially stabilized upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab

    Biological materials


  • MGNA-A149 (yrhF::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE27210 (Δ[gene|CEA3119463DAA65A18F891479B955235154AE402|yrhF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTGATTACCCCTTCCG, downstream forward: _UP4_TAGTATATTTGTCATTGACA
  • BKK27210 (Δ[gene|CEA3119463DAA65A18F891479B955235154AE402|yrhF]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTGATTACCCCTTCCG, downstream forward: _UP4_TAGTATATTTGTCATTGACA
  • References

  • 21815947