SubtiBank SubtiBank
ybfF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ybfF

unknown
locus
BSU_02190
pI
9.67
mw
35.16 kDa
protein length
303 aa Sequence Blast
gene length
912 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    238,644 → 239,555

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|5D159F09BFD98B58A7EDAD37A4DB6468A702D09A|ybfG]-[gene|CEA0A2CE520B8A6E8E9D7C079B954B24137DF686|ybfF]-[gene|3E2A864B904DE4D9F72D2B19257AE81CCED3BE12|ybfE]
    description
    [Pubmed|22383849]

    regulation

  • the mRNA is processed between [gene|5D159F09BFD98B58A7EDAD37A4DB6468A702D09A|ybfG] and [gene|CEA0A2CE520B8A6E8E9D7C079B954B24137DF686|ybfF] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B967 (ybfF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1966 NBRP B. subtilis, Japan]
  • BKE02190 (Δ[gene|CEA0A2CE520B8A6E8E9D7C079B954B24137DF686|ybfF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTGATAAACCTCCAA, downstream forward: _UP4_TAATTTTGTTTCATCCTTAC
  • BKK02190 (Δ[gene|CEA0A2CE520B8A6E8E9D7C079B954B24137DF686|ybfF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTGATAAACCTCCAA, downstream forward: _UP4_TAATTTTGTTTCATCCTTAC
  • References

    Research papers

  • 29794222