SubtiBank SubtiBank
trmR
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

trmR

tRNA wobble uridine modifying methyltransferase
locus
BSU_27360
pI
5.57
mw
24.92 kDa
protein length
217 aa Sequence Blast
gene length
654 bp Sequence Blast
function
introduction of 5-methoxyuridine modification in tRNA (U34)
product
tRNA wobble uridine modifying methyltransferase
essential
no
synonyms
yrrM

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.8|tRNA modification and maturation]
  • Gene

    Coordinates
    2,795,082 → 2,795,735

    The protein

    Catalyzed reaction/ biological activity

  • methylation of (5-hydroxyuridine) ho5U containing tRNA to 5-methoxyuridine (mo5U) [pubmed|29982645]
  • 5-hydroxyuridine34 in tRNA + S-adenosyl-L-methionine --> 5-methoxyuridine34 in tRNA + H+ + S-adenosyl-L-homocysteine (according to UniProt)
  • Protein family

  • [SW|Methyltransferase superfamily] (according to UniProt)
  • [SW|class I-like SAM-binding methyltransferase superfamily] (according to UniProt)
  • [SW|Cofactors]

  • SAM [pubmed|29982645]
  • Structure

  • [PDB|5ZW3] [pubmed|29982645]
  • [PDB|5ZW4] (bound to tRNA) [pubmed|29982645]
  • Expression and Regulation

    Operons

    genes
    [gene|CE4F2965077F2A5882432D683520E09B70B9369A|trmR]-[gene|A3EC327DA14F188E88AF4221B51EE5950F882277|yrrN]-[gene|D4046AA4C4ACB6A0A2F2020CA1E659F65CAFE68D|yrrO]-[gene|A659D9894E777D8A99707CB750DF2918AEE06CE9|udk]-[gene|6FBF27C12B4B3DC2CE373E5199357042114471F8|greA]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A853 (yrrM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/853 NBRP B. subtilis, Japan]
  • BKE27360 (Δ[gene|CE4F2965077F2A5882432D683520E09B70B9369A|trmR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTACAAACAGCCTCCCGT, downstream forward: _UP4_AGTAAAAAGAAGAGGTGAAC
  • BKK27360 (Δ[gene|CE4F2965077F2A5882432D683520E09B70B9369A|trmR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTACAAACAGCCTCCCGT, downstream forward: _UP4_AGTAAAAAGAAGAGGTGAAC
  • References

    Research papers

  • 29982645,31358606