SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


amino acid permease
50.49 kDa
protein length
462 aa Sequence Blast
gene length
1389 bp Sequence Blast
amino acid uptake
amino acid permease

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Amino acid transporters] → [category|SW|Other amino acid transporters]
  • Gene

    2,766,558 → 2,767,946

    The protein

    Protein family

  • [SW|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|1594BA83CED2DA9F86C1CE2A0DC6E1C9B665EACB|GabP], [protein|219586A3F378DC38EA076FD39B99D41136BDE722|YtnA], [protein|423AEC9D260BE53AD22851D999244B89BEB3E84D|HutM], [protein|8C4A8961B2514A8AD531AFB104B10C0797D02AC2|YvbW], [protein|9AD0E43119BDC65D5F67CE55CD9417E1E6BAE058|YbxG], [protein|9BFB16C12B31ABD70BBB921BCB9E4201E3BDC92D|RocC], [protein|B46A8BCEC56E6252712E30F8BF8DA6B836FDE2F6|RocE], [protein|B6A920650919D5BBBD75CCA58C30A0D8ECE64DA3|YbgF], [protein|C7FEA1D9C7C96C39CEE83CE3F13D412DE6AFE10E|YdgF]
  • Structure

  • [PDB|3NCY] (from Salmonella typhimurium, 21% identity) [pubmed|19578361]
  • Expression and Regulation


    view in new tab

    Biological materials


  • GP2377 Δ''[gene|CE4A49F5CCC2D36C5CE5AD7AE7F0A70F2D4F425C|aapA]''::''tet'', available in [SW|Jörg Stülke]'s lab
  • MGNA-A230 (aapA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE27090 (Δ[gene|CE4A49F5CCC2D36C5CE5AD7AE7F0A70F2D4F425C|aapA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTTTATTTTCCTCCAGT, downstream forward: _UP4_TAAAAAAAAGACAAGGGATA
  • BKK27090 (Δ[gene|CE4A49F5CCC2D36C5CE5AD7AE7F0A70F2D4F425C|aapA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTTTATTTTCCTCCAGT, downstream forward: _UP4_TAAAAAAAAGACAAGGGATA
  • Expression vector

  • pGP2279: expression of ''aapA'' by [SW|pBQ200] in ''B. subtilis'', available in [SW|Jörg Stülke]'s lab
  • lacZ fusion

  • pGP2273 (in [SW|pAC5]) (GP2960), available in [SW|Jörg Stülke]'s lab
  • References

    Research papers

  • 19578361