SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


amino acid permease
50.49 kDa
protein length
462 aa Sequence Blast
gene length
1389 bp Sequence Blast
amino acid uptake
amino acid permease

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Amino acid transporters] → [category|SW|APC superfamily]
  • Gene

    2,766,558 → 2,767,946

    The protein

    Protein family

  • [SW|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|1594BA83CED2DA9F86C1CE2A0DC6E1C9B665EACB|GabP], [protein|219586A3F378DC38EA076FD39B99D41136BDE722|YtnA], [protein|423AEC9D260BE53AD22851D999244B89BEB3E84D|HutM], [protein|8C4A8961B2514A8AD531AFB104B10C0797D02AC2|YvbW], [protein|9AD0E43119BDC65D5F67CE55CD9417E1E6BAE058|YbxG], [protein|9BFB16C12B31ABD70BBB921BCB9E4201E3BDC92D|RocC], [protein|B46A8BCEC56E6252712E30F8BF8DA6B836FDE2F6|RocE], [protein|B6A920650919D5BBBD75CCA58C30A0D8ECE64DA3|YbgF], [protein|C7FEA1D9C7C96C39CEE83CE3F13D412DE6AFE10E|YdgF]
  • Structure

  • [PDB|3NCY] (from Salmonella typhimurium, 21% identity) [pubmed|19578361]
  • Expression and Regulation


    view in new tab

    Biological materials


  • GP2377 Δ''[gene|CE4A49F5CCC2D36C5CE5AD7AE7F0A70F2D4F425C|aapA]''::''tet'', available in [SW|Jörg Stülke]'s lab [pubmed|32743959]
  • MGNA-A230 (aapA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE27090 (Δ[gene|CE4A49F5CCC2D36C5CE5AD7AE7F0A70F2D4F425C|aapA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTTTATTTTCCTCCAGT, downstream forward: _UP4_TAAAAAAAAGACAAGGGATA
  • BKK27090 (Δ[gene|CE4A49F5CCC2D36C5CE5AD7AE7F0A70F2D4F425C|aapA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTTTATTTTCCTCCAGT, downstream forward: _UP4_TAAAAAAAAGACAAGGGATA
  • Expression vector

  • pGP2279: expression of ''aapA'' by [SW|pBQ200] in ''B. subtilis'', available in [SW|Jörg Stülke]'s lab
  • lacZ fusion

  • pGP2273 (in [SW|pAC5]) (GP2960), available in [SW|Jörg Stülke]'s lab
  • References

    Research papers

  • 19578361