SubtiBank SubtiBank
aapA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

aapA

amino acid permease
locus
BSU_27090
pI
9.68
mw
50.49 kDa
protein length
462 aa Sequence Blast
gene length
1389 bp Sequence Blast
function
amino acid uptake
product
amino acid permease
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.1|Amino acid transporters] → [category|SW 1.2.4.1.2|Other amino acid transporters]
  • Gene

    Coordinates
    2,766,558 → 2,767,946

    The protein

    Protein family

  • [SW|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|1594BA83CED2DA9F86C1CE2A0DC6E1C9B665EACB|GabP], [protein|219586A3F378DC38EA076FD39B99D41136BDE722|YtnA], [protein|423AEC9D260BE53AD22851D999244B89BEB3E84D|HutM], [protein|8C4A8961B2514A8AD531AFB104B10C0797D02AC2|YvbW], [protein|9AD0E43119BDC65D5F67CE55CD9417E1E6BAE058|YbxG], [protein|9BFB16C12B31ABD70BBB921BCB9E4201E3BDC92D|RocC], [protein|B46A8BCEC56E6252712E30F8BF8DA6B836FDE2F6|RocE], [protein|B6A920650919D5BBBD75CCA58C30A0D8ECE64DA3|YbgF], [protein|C7FEA1D9C7C96C39CEE83CE3F13D412DE6AFE10E|YdgF]
  • Structure

  • [PDB|3NCY] (from Salmonella typhimurium, 21% identity) [pubmed|19578361]
  • Expression and Regulation

    Operons

    genes
    [gene|CE4A49F5CCC2D36C5CE5AD7AE7F0A70F2D4F425C|aapA]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • GP2377 Δ''[gene|CE4A49F5CCC2D36C5CE5AD7AE7F0A70F2D4F425C|aapA]''::''tet'', available in [SW|Jörg Stülke]'s lab
  • MGNA-A230 (aapA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/230 NBRP B. subtilis, Japan]
  • BKE27090 (Δ[gene|CE4A49F5CCC2D36C5CE5AD7AE7F0A70F2D4F425C|aapA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTTTATTTTCCTCCAGT, downstream forward: _UP4_TAAAAAAAAGACAAGGGATA
  • BKK27090 (Δ[gene|CE4A49F5CCC2D36C5CE5AD7AE7F0A70F2D4F425C|aapA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTTTATTTTCCTCCAGT, downstream forward: _UP4_TAAAAAAAAGACAAGGGATA
  • Expression vector

  • pGP2279: expression of ''aapA'' by [SW|pBQ200] in ''B. subtilis'', available in [SW|Jörg Stülke]'s lab
  • lacZ fusion

  • pGP2273 (in [SW|pAC5]) (GP2960), available in [SW|Jörg Stülke]'s lab
  • References

    Research papers

  • 19578361