SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


putative tRNA-dihydrouridine synthase B
36.91 kDa
protein length
333 aa Sequence Blast
gene length
1002 bp Sequence Blast
tRNA maturation
putative tRNA-dihydrouridine synthase B

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|tRNA modification and maturation]
  • Gene

    87,634 → 88,635

    The protein

    Catalyzed reaction/ biological activity

  • 5,6-dihydrouridine in tRNA + NAD+ --> uridine in tRNA + H+ + NADH (according to UniProt)
  • 5,6-dihydrouridine in tRNA + NADP+ --> uridine in tRNA + H+ + NADPH (according to UniProt)
  • Protein family

  • Dus family (with [protein|B1C2BD8CEEABF9BBAE2646E8E24457A485097CFC|YfjN], according to UniProt)
  • Paralogous protein(s)

  • [protein|B1C2BD8CEEABF9BBAE2646E8E24457A485097CFC|YfjN]
  • [SW|Cofactors]

  • FMN or FAD [Pubmed|21635694]
  • Structure

  • [PDB|1VHN] (from ''Thermotoga maritima'', 35% identity, 54% similarity) [Pubmed|15103641]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9084182], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulation

  • translation repressed by tryptophan ([protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]) [Pubmed|9084182]
  • view in new tab

    additional information

  • the mRNA is very stable (> 15 min) [pubmed|12884008]
  • Biological materials


  • MGNA-B927 (yacF::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE00810 (Δ[gene|CE45D56BC413555AF4E7914B5307AD967A358452|yacF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTTTTCTCCTCCTTTCA, downstream forward: _UP4_TAATACTCACCTCTATTTGC
  • BKK00810 (Δ[gene|CE45D56BC413555AF4E7914B5307AD967A358452|yacF]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTTTTCTCCTCCTTTCA, downstream forward: _UP4_TAATACTCACCTCTATTTGC
  • References

  • 12884008,9084182,25902496