SubtiBank SubtiBank
ypbH [2018-02-11T01:31:12.000Z]
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ypbH [2018-02-11T01:31:12.000Z]

putative adaptor protein for ClpC-ClpP
locus
BSU22970
pI
4.09
mw
22.01 kDa
protein length
194 aa Sequence Blast
gene length
582 bp Sequence Blast
function
unknown
product
putative adaptor protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW 3.3.7.4|Additional proteins involved in proteolysis]
  • Gene

    Coordinates
    2,403,506 → 2,404,090

    Phenotypes of a mutant

  • deletion reduces sporulation to 20%, overexpression abolishes sporulation [Pubmed|11914365]
  • The protein

    Paralogous protein(s)

  • [protein|331993A875907C10C77105FD8DDD86D4412CE405|MecA]
  • Structure

  • [http://www.proteopedia.org/wiki/index.php/3jto 3JTO] (C-terminal domain) [Pubmed|19801546]
  • Expression and Regulation

    Operons

    genes
    [gene|CE1C46944E242006383BA77B2C4E09045CB3B93F|ypbH]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A415 (ypbH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/415 NBRP B. subtilis, Japan]
  • GP812 (spc), GP814 (spc) both available in the [SW|Stülke] lab
  • BKE22970 (Δ[gene|CE1C46944E242006383BA77B2C4E09045CB3B93F|ypbH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACGTTCCCTCCTGCCT, downstream forward: _UP4_TAAGAATGCAACGGAAAACT
  • BKK22970 (Δ[gene|CE1C46944E242006383BA77B2C4E09045CB3B93F|ypbH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACGTTCCCTCCTGCCT, downstream forward: _UP4_TAAGAATGCAACGGAAAACT
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • References

    Reviews

  • 19609260,23375660
  • Original Publications

  • 11914365,19801546