SubtiBank SubtiBank
ypbH [2019-06-27 14:21:28]
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ypbH [2019-06-27 14:21:28]

putative adaptor protein for [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP]
22.01 kDa
protein length
194 aa Sequence Blast
gene length
585 bp Sequence Blast
putative adaptor protein

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW|Additional proteins involved in proteolysis]
  • Gene

    2,403,506 → 2,404,090

    Phenotypes of a mutant

  • deletion reduces sporulation to 20%, overexpression abolishes sporulation [Pubmed|11914365]
  • The protein

    Paralogous protein(s)

  • [protein|331993A875907C10C77105FD8DDD86D4412CE405|MecA]
  • Structure

  • [PDB|3JTO] (C-terminal domain) [Pubmed|19801546]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A415 (ypbH::erm), available at the [ NBRP B. subtilis, Japan]
  • GP812 (spc), GP814 (spc) both available in the [SW|Stülke] lab
  • BKE22970 (Δ[gene|CE1C46944E242006383BA77B2C4E09045CB3B93F|ypbH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACGTTCCCTCCTGCCT, downstream forward: _UP4_TAAGAATGCAACGGAAAACT
  • BKK22970 (Δ[gene|CE1C46944E242006383BA77B2C4E09045CB3B93F|ypbH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACGTTCCCTCCTGCCT, downstream forward: _UP4_TAAGAATGCAACGGAAAACT
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • References


  • 19609260,23375660
  • Original Publications

  • 11914365,19801546