SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


putative adaptor protein for [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP]
22.01 kDa
protein length
194 aa Sequence Blast
gene length
585 bp Sequence Blast
putative adaptor protein

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW|Additional proteins involved in proteolysis]
  • Gene

    2,403,506 → 2,404,090

    Phenotypes of a mutant

  • deletion reduces sporulation to 20%, overexpression abolishes sporulation [Pubmed|11914365]
  • The protein

    Protein family

  • mecA family (with [protein|331993A875907C10C77105FD8DDD86D4412CE405|MecA], according to UniProt)
  • Paralogous protein(s)

  • [protein|331993A875907C10C77105FD8DDD86D4412CE405|MecA]
  • Structure

  • [PDB|3JTO] (C-terminal domain) [Pubmed|19801546]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A415 (ypbH::erm), available at the [ NBRP B. subtilis, Japan]
  • GP812 (spc), GP814 (spc) both available in the [SW|Stülke] lab
  • BKE22970 (Δ[gene|CE1C46944E242006383BA77B2C4E09045CB3B93F|ypbH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACGTTCCCTCCTGCCT, downstream forward: _UP4_TAAGAATGCAACGGAAAACT
  • BKK22970 (Δ[gene|CE1C46944E242006383BA77B2C4E09045CB3B93F|ypbH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACGTTCCCTCCTGCCT, downstream forward: _UP4_TAAGAATGCAACGGAAAACT
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • References


  • 19609260,23375660
  • Original Publications

  • 11914365,19801546