SubtiBank SubtiBank
yorK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yorK

single-strand DNA-specific exonuclease
locus
BSU_20350
pI
6.56
mw
65.60 kDa
protein length
576 aa Sequence Blast
gene length
1731 bp Sequence Blast
function
unknown
product
single-strand DNA-specific exonuclease
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.6|DNA repair/ recombination/ based on similarity]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.7|Phosphorylation on a Tyr residue]
  • Gene

    Coordinates
    2,179,526 → 2,181,256

    The protein

    Protein family

  • RecJ family (with [protein|BA755FA1CB1E0C006E9A23489A7C8997141AA498|RecJ], according to UniProt)
  • Paralogous protein(s)

  • [protein|BA755FA1CB1E0C006E9A23489A7C8997141AA498|RecJ]
  • [SW|Domains]

  • [SW|DHH-DHHA1 domain]
  • Modification

  • phosphorylation on Tyr-473 [Pubmed|17218307]
  • Structure

  • [PDB|5F54] (from Deinococcus radiodurans, the [SW|DHH-DHHA1 domain], 23% identity) [pubmed|27058167]
  • Biological materials

    Mutant

  • BKE20350 (Δ[gene|CDFA18E1C0445302ED4D8F93F88822EC6BD646BB|yorK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE20350 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTCGCCAATTAGTCTATACT, downstream forward: _UP4_CTTGTGTTTTAAGGGGGAGA
  • BKK20350 (Δ[gene|CDFA18E1C0445302ED4D8F93F88822EC6BD646BB|yorK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK20350 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTCGCCAATTAGTCTATACT, downstream forward: _UP4_CTTGTGTTTTAAGGGGGAGA
  • References

  • 17218307,10498723,27058167