SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


49.10 kDa
protein length
432 aa Sequence Blast
gene length
1299 bp Sequence Blast
utilization of melibiose and raffinose family oligosaccharides (raffinose, stachyose)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of melibiose]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    3,100,881 → 3,102,179

    The protein

    Catalyzed reaction/ biological activity

  • Hydrolysis of terminal, non-reducing alpha-D-galactose residues in alpha-D-galactosides, including galactose oligosaccharides, galactomannans and galactolipids (according to UniProt)
  • Protein family

  • [SW|Glycosyl hydrolase 4 family] (according to UniProt)
  • Kinetic information

  • KM for melibiose: 10 mM [pubmed|31138628]
  • KM for raffinose: 25 mM [pubmed|31138628]
  • [SW|Cofactors]

  • NAD+ [pubmed|31138628]
  • Mn2+ [pubmed|31138628]
  • Structure

  • [PDB|5C3M] (from Geobacillus stearothermophilus, 28% identity)
  • Expression and Regulation


    view in new tab


    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|22900538,31138628], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|22900538], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|58276E6FEF9388BBC7FB79BB5A3A1EF3C3DA5BD5|MelR]: repression, [pubmed|31138628], in [regulon|58276E6FEF9388BBC7FB79BB5A3A1EF3C3DA5BD5|MelR regulon]
  • regulation

  • induced by melibiose or raffinose ([protein|58276E6FEF9388BBC7FB79BB5A3A1EF3C3DA5BD5|MelR]) [pubmed|31138628]
  • repressed by glucose ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]) [Pubmed|22900538,31138628]
  • there is an additional RNA "upshift" signal in front of the [gene|C3D7C64AD0E58BF326257E23136466A237138B50|melE] gene suggestive of a [gene|C3D7C64AD0E58BF326257E23136466A237138B50|melE]-[gene|05BFEA711D82395A55B505E5A38286BE2F570350|melD]-[gene|4E766839240C8F7D56D87DF9E7B99350A83B5FF7|melC]-[gene|CDE9EF9CFB799794D525F12DEC8C4190C6298575|melA] mRNA [Pubmed|22383849]. However, there is no promoter in front of [gene|C3D7C64AD0E58BF326257E23136466A237138B50|melE], suggesting that this mRNA may be the product of mRNA processing [pubmed|31138628]
  • view in new tab

    Biological materials


  • BKE30300 (Δ[gene|CDE9EF9CFB799794D525F12DEC8C4190C6298575|melA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCATATTGCTTCCCCCTT, downstream forward: _UP4_TAAAAACTAGGGGACCGCTC
  • BKK30300 (Δ[gene|CDE9EF9CFB799794D525F12DEC8C4190C6298575|melA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCATATTGCTTCCCCCTT, downstream forward: _UP4_TAAAAACTAGGGGACCGCTC
  • References

  • 9387221,22383849,22900538,31138628