SubtiBank SubtiBank
melA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

melA

alpha-galactosidase
locus
BSU30300
pI
5.84
mw
49.10 kDa
protein length
432 aa Sequence Blast
gene length
1299 bp Sequence Blast
function
utilization of melibiose and raffinose family oligosaccharides (raffinose, stachyose)
product
alpha-galactosidase
essential
no
ec
3.2.1.22
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.21|Utilization of melibiose]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    3,100,881 → 3,102,179

    The protein

    Catalyzed reaction/ biological activity

  • Hydrolysis of terminal, non-reducing alpha-D-galactose residues in alpha-D-galactosides, including galactose oligosaccharides, galactomannans and galactohydrolase (according to Swiss-Prot)
  • Protein family

  • [SW|Glycosyl hydrolase 4 family] (according to UniProt)
  • Kinetic information

  • KM for melibiose: 10 mM [pubmed|31138628]
  • KM for raffinose: 25 mM [pubmed|31138628]
  • [SW|Cofactors]

  • NAD+ [pubmed|31138628]
  • Mn2+ [pubmed|31138628]
  • Structure

  • [PDB|5C3M] (from Geobacillus stearothermophilus, 28% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|CDE9EF9CFB799794D525F12DEC8C4190C6298575|melA]
    description
    [Pubmed|22383849,9387221]
    view in new tab

    genes
    [gene|58276E6FEF9388BBC7FB79BB5A3A1EF3C3DA5BD5|melR]-[gene|C3D7C64AD0E58BF326257E23136466A237138B50|melE]-[gene|05BFEA711D82395A55B505E5A38286BE2F570350|melD]-[gene|4E766839240C8F7D56D87DF9E7B99350A83B5FF7|melC]-[gene|CDE9EF9CFB799794D525F12DEC8C4190C6298575|melA]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|22900538,31138628], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|22900538], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|58276E6FEF9388BBC7FB79BB5A3A1EF3C3DA5BD5|MelR]: repression, [pubmed|31138628], in [regulon|58276E6FEF9388BBC7FB79BB5A3A1EF3C3DA5BD5|MelR regulon]
  • regulation

  • induced by melibiose or raffinose ([protein|58276E6FEF9388BBC7FB79BB5A3A1EF3C3DA5BD5|MelR]) [pubmed|31138628]
  • repressed by glucose ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]) [Pubmed|22900538,31138628]
  • there is an additional RNA "upshift" signal in front of the [gene|C3D7C64AD0E58BF326257E23136466A237138B50|melE] gene suggestive of a [gene|C3D7C64AD0E58BF326257E23136466A237138B50|melE]-[gene|05BFEA711D82395A55B505E5A38286BE2F570350|melD]-[gene|4E766839240C8F7D56D87DF9E7B99350A83B5FF7|melC]-[gene|CDE9EF9CFB799794D525F12DEC8C4190C6298575|melA] mRNA [Pubmed|22383849]. However, there is no promoter in front of [gene|C3D7C64AD0E58BF326257E23136466A237138B50|melE], suggesting that this mRNA may be the product of mRNA processing [pubmed|31138628]
  • view in new tab

    Biological materials

    Mutant

  • BKE30300 (Δ[gene|CDE9EF9CFB799794D525F12DEC8C4190C6298575|melA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCATATTGCTTCCCCCTT, downstream forward: _UP4_TAAAAACTAGGGGACCGCTC
  • BKK30300 (Δ[gene|CDE9EF9CFB799794D525F12DEC8C4190C6298575|melA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCATATTGCTTCCCCCTT, downstream forward: _UP4_TAAAAACTAGGGGACCGCTC
  • References

  • 9387221,22383849,22900538,31138628