SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


S-adenosylmethionine decarboxylase, required for biofilm formation
13.96 kDa
protein length
126 aa Sequence Blast
gene length
381 bp Sequence Blast
spermidine, polyamine biosynthesis
S-adenosylmethionine decarboxylase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW|Metabolism of polyamines]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Other proteins required for biofilm formation]
  • Gene

    2,966,413 → 2,966,793

    Phenotypes of a mutant

  • no [SW|biofilm formation] [Pubmed|24529384]
  • The protein

    Catalyzed reaction/ biological activity

  • H+ + S-adenosyl-L-methionine --> CO2 + S-adenosyl 3-(methylsulfanyl)propylamine (according to UniProt)
  • Protein family

  • prokaryotic AdoMetDC family (single member, according to UniProt)
  • Structure

  • [PDB|1VR7] (from ''Thermotoga maritima'', 47% identity, 72% similarity)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|15720552], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|CcpN]: repression, [Pubmed|15720552], in [regulon|2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|CcpN regulon]
  • regulation

  • ''[protein|search|gapB]'': repressed in the presence of glucose ([protein|search|CcpN]) [Pubmed|15720552]
  • additional information

  • '[protein|search|speD]': the mRNA is substantially stabilized upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] (the half-life of the monocistronic 'speD' mRNA increases from 1.4 to 36 min) [PubMed|21815947]
  • view in new tab



  • ''[protein|search|gapB]'': repressed in the presence of glucose ([protein|search|CcpN]) [Pubmed|15720552]
  • additional information

  • '[protein|search|speD]': the mRNA is substantially stabilized upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] (the half-life of the monocistronic 'speD' mRNA increases from 1.4 to 36 min) [PubMed|21815947]
  • view in new tab

    Biological materials


  • MGNA-A122 (ytcF::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE29010 (Δ[gene|CDD5C7B1CE58352D29BB86BCC2C3685D1D8898ED|speD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGTCATGGACCCCCCTT, downstream forward: _UP4_TAAAGTAAATTGCGAACACA
  • BKK29010 (Δ[gene|CDD5C7B1CE58352D29BB86BCC2C3685D1D8898ED|speD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGTCATGGACCCCCCTT, downstream forward: _UP4_TAAAGTAAATTGCGAACACA
  • GP2599 (Δ[gene|CDD5C7B1CE58352D29BB86BCC2C3685D1D8898ED|speD]::tet comIQ12L) (in DK1042), available in [SW|Jörg Stülke]'s lab
  • Expression vector

  • pGP2324: for expression in B. subtilis, in [SW|pBQ200],available in [SW|Jörg Stülke]'s lab
  • References

  • 10844697,15720552,9723923,21815947,24529384,28546427