SubtiBank SubtiBank
reoY
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

reoY

effector protein of [protein|DA763F7C2192655C590752C2A285ADF902B11BCA|MurAA] degradation by [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP]
locus
BSU_22580
pI
5.88
mw
21.22 kDa
protein length
179 aa Sequence Blast
gene length
540 bp Sequence Blast
function
control of peptidoglycan biosynthesis
product
regulator of [protein|DA763F7C2192655C590752C2A285ADF902B11BCA|MurAA] degradation
essential
no
synonyms
ypiB

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.5|Cell wall/ other]
  • Gene

    Coordinates
    2,365,736 → 2,366,275

    Phenotypes of a mutant

  • accumulation of [protein|DA763F7C2192655C590752C2A285ADF902B11BCA|MurAA] due to reduced degradation by [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP] [pubmed|32469310]
  • The protein

    Protein family

  • UPF0302 family (single member, according to UniProt)
  • Structure

  • [PDB|3DO9] (from B. anthracis, 64% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|057BFF91609C918CEE4E6FF9100A1E4959BF6715|ypiA]-[gene|CDBBCB467FE9442B3CE45CF9401C609295E1B99F|reoY]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|CDBBCB467FE9442B3CE45CF9401C609295E1B99F|reoY]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A408 (ypiB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/408 NBRP B. subtilis, Japan]
  • BKE22580 (Δ[gene|CDBBCB467FE9442B3CE45CF9401C609295E1B99F|reoY]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTAATTCCCTCCTCTAT, downstream forward: _UP4_TAATATGACCAGCCTTGCAG
  • BKK22580 (Δ[gene|CDBBCB467FE9442B3CE45CF9401C609295E1B99F|reoY]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTAATTCCCTCCTCTAT, downstream forward: _UP4_TAATATGACCAGCCTTGCAG
  • References

    Research papers

  • 32469310