SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


PBSX prophage
144.92 kDa
protein length
1332 aa Sequence Blast
gene length
3999 bp Sequence Blast

Genomic Context



  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.1|PBSX prophage]
  • Gene

    1,334,966 → 1,338,964

    Expression and Regulation



    sigma factors

  • [protein|458406A4E6824C24493CFC19718F10720AA3B453|Xpf]: sigma factor, [Pubmed|8083174], in [regulon|458406A4E6824C24493CFC19718F10720AA3B453|Xpf regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials


  • BKE12680 (Δ[gene|CD97483876F4FCCE451AD4F2A8AFD6F560074769|xkdO]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAAACGGGCTGTTAATTTTG, downstream forward: _UP4_ATTGGAACGAAGGGAGTCGT
  • BKK12680 (Δ[gene|CD97483876F4FCCE451AD4F2A8AFD6F560074769|xkdO]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAAACGGGCTGTTAATTTTG, downstream forward: _UP4_ATTGGAACGAAGGGAGTCGT