SubtiBank SubtiBank
yozI
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yozI

unknown
locus
BSU_18870
pI
4.15
mw
13.81 kDa
protein length
121 aa Sequence Blast
gene length
366 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,057,214 → 2,057,579

    Biological materials

    Mutant

  • MGNA-B405 (yozI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1404 NBRP B. subtilis, Japan]
  • BKE18870 (Δ[gene|CD91B207D88B20306AE07CBA570C71C0BB1372F3|yozI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCAATCCCTCTTTATA, downstream forward: _UP4_TAAGCAGATCCAAGCCCCCA
  • BKK18870 (Δ[gene|CD91B207D88B20306AE07CBA570C71C0BB1372F3|yozI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCAATCCCTCTTTATA, downstream forward: _UP4_TAAGCAGATCCAAGCCCCCA