SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


putative CDP-glycerol:poly(glycerophosphate) glycerophosphotransferase (fragment)
0.00 kDa
protein length
gene length
207 bp Sequence Blast
putative CDP-glycerol:poly(glycerophosphate) glycerophosphotransferase

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.10|Pseudogenes]
  • Gene

    3,671,416 → 3,671,622

    Biological materials


  • BKE35698 (Δ[gene|CD897005BD4E84FFC2CBEB4E8074949AEC1B9CD7|yvzI]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAAAAAATACAAGGTTTT, downstream forward: _UP4_TAATTGAAACGATCCTTTAA
  • BKK35698 (Δ[gene|CD897005BD4E84FFC2CBEB4E8074949AEC1B9CD7|yvzI]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAAAAAATACAAGGTTTT, downstream forward: _UP4_TAATTGAAACGATCCTTTAA