SubtiBank SubtiBank
yvzI
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yvzI

putative CDP-glycerol:poly(glycerophosphate) glycerophosphotransferase (fragment)
locus
BSU_35698
pI
0.00
mw
0.00 kDa
protein length
gene length
207 bp Sequence Blast
function
unknown
product
putative CDP-glycerol:poly(glycerophosphate) glycerophosphotransferase
essential
-
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.10|Pseudogenes]
  • Gene

    Coordinates
    3,671,416 → 3,671,622

    Biological materials

    Mutant

  • BKE35698 (Δ[gene|CD897005BD4E84FFC2CBEB4E8074949AEC1B9CD7|yvzI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35698 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAAAAAATACAAGGTTTT, downstream forward: _UP4_TAATTGAAACGATCCTTTAA
  • BKK35698 (Δ[gene|CD897005BD4E84FFC2CBEB4E8074949AEC1B9CD7|yvzI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35698 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAAAAAATACAAGGTTTT, downstream forward: _UP4_TAATTGAAACGATCCTTTAA