SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


14.63 kDa
protein length
132 aa Sequence Blast
gene length
399 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    1,284,371 → 1,284,769

    Expression and Regulation


    view in new tab

    view in new tab

    Biological materials


  • MGNA-A385 (yjgA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE12140 (Δ[gene|CD7243CC1AB60C36E8D8AB8C92679DBA991237F1|yjgA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCGAATTGATACCCCG, downstream forward: _UP4_CGCCGCTGTATGTGACGCTT
  • BKK12140 (Δ[gene|CD7243CC1AB60C36E8D8AB8C92679DBA991237F1|yjgA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCGAATTGATACCCCG, downstream forward: _UP4_CGCCGCTGTATGTGACGCTT