SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


glutamine [SW|ABC transporter] (membrane protein)
24.02 kDa
protein length
218 aa Sequence Blast
gene length
657 bp Sequence Blast
glutamine uptake
glutamine [SW|ABC transporter] (membrane protein)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Importers] → [category|SW|Uptake of amino acids]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of glutamate/ glutamine/ ammonium assimilation]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW|Utilization of glutamine/ glutamate]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,804,657 → 2,805,313

    The protein

    Protein family

  • [SW|Binding-protein-dependent transport system permease family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|6CE6AFDBE85974B45041DE924A09CC9F56ED79D8|GlnM]
  • [SW|Domains]

  • [SW|ABC transmembrane type-1 domain] (aa 19-210) (according to UniProt)
  • Structure

  • [PDB|4YMS] (complex with [protein|6CE6AFDBE85974B45041DE924A09CC9F56ED79D8|GlnM]; from ''Thermoanaerobacter tengcongensis '', 31% identity) [Pubmed|25848002]
  • [SW|Localization]

  • cell membrane [Pubmed|10092453]
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|12823818], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • regulation

  • expressed during sporulation ([protein|search|SigE]) [Pubmed|15699190]
  • view in new tab

    Biological materials


  • BKE27460 (Δ[gene|CD32011A08697B2C121996A02F1BD7BE4F932778|glnP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GAAATCCAATGTAACTCACT, downstream forward: _UP4_TAGAAAAGGATACTCTTTGG
  • BKK27460 (Δ[gene|CD32011A08697B2C121996A02F1BD7BE4F932778|glnP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GAAATCCAATGTAACTCACT, downstream forward: _UP4_TAGAAAAGGATACTCTTTGG
  • References

  • 10092453,25755103,12823818,15699190,25848002,20023025,29432725