SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


lethal when synthesized during vegetative growth in the absence of [protein|6C9F403D67CDC2EE66C534B0F23D973E24C9A089|SpoIISB]
28.91 kDa
protein length
248 aa Sequence Blast
gene length
747 bp Sequence Blast
programmed cell death

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins] → [category|SW|Type 2 TA systems]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,348,612 → 1,349,358

    The protein

    Protein family

  • SpoIISA toxin family (single member, according to UniProt)
  • [SW|Domains]

  • three putative membrane-spanning segments and a cytoplasmic domain
  • Structure

  • [PDB|3O6Q] (cytoplasmic fragment of [protein|CD14C88E9976964A0D25BAA22C395A5A6951654D|SpoIISA] (CSpoIISA) in complex with [protein|6C9F403D67CDC2EE66C534B0F23D973E24C9A089|SpoIISB]) [Pubmed|21147767]
  • [SW|Localization]

  • cell membrane [Pubmed|20863891]
  • Expression and Regulation



    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • view in new tab

    Biological materials


  • MGNA-A006 (spoIISA::erm), available at the [ NBRP B. subtilis, Japan]
  • 1S123 ( ''spoIISA''::''kan''), [Pubmed|11371520], available at [ BGSC]
  • BKE12830 (Δ[gene|CD14C88E9976964A0D25BAA22C395A5A6951654D|spoIISA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCGAATCCCTCACAT, downstream forward: _UP4_ATTGAGGAGGAAGGTGAAGG
  • BKK12830 (Δ[gene|CD14C88E9976964A0D25BAA22C395A5A6951654D|spoIISA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCGAATCCCTCACAT, downstream forward: _UP4_ATTGAGGAGGAAGGTGAAGG
  • References


  • 31075979
  • Original publications

  • 18096016,11371520,21147767,25039482,20863891,26300872,27294956