SubtiBank SubtiBank
spoIISA
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

spoIISA

lethal when synthesized during vegetative growth in the absence of [protein|6C9F403D67CDC2EE66C534B0F23D973E24C9A089|SpoIISB]
locus
BSU_12830
pI
4.68
mw
28.91 kDa
protein length
248 aa Sequence Blast
gene length
747 bp Sequence Blast
function
programmed cell death
product
toxin
essential
no
synonyms
ykaC

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins] → [category|SW 4.3.17.2|Type 2 TA systems]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,348,612 → 1,349,358

    The protein

    Protein family

  • SpoIISA toxin family (single member, according to UniProt)
  • [SW|Domains]

  • three putative membrane-spanning segments and a cytoplasmic domain
  • Structure

  • [PDB|3O6Q] (cytoplasmic fragment of [protein|CD14C88E9976964A0D25BAA22C395A5A6951654D|SpoIISA] (CSpoIISA) in complex with [protein|6C9F403D67CDC2EE66C534B0F23D973E24C9A089|SpoIISB]) [Pubmed|21147767]
  • [SW|Localization]

  • cell membrane [Pubmed|20863891]
  • Expression and Regulation

    Operons

    genes
    [gene|CD14C88E9976964A0D25BAA22C395A5A6951654D|spoIISA]-[gene|6C9F403D67CDC2EE66C534B0F23D973E24C9A089|spoIISB]
    description
    [Pubmed|11371520]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A006 (spoIISA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/6 NBRP B. subtilis, Japan]
  • 1S123 ( ''spoIISA''::''kan''), [Pubmed|11371520], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S123&Search=1S123 BGSC]
  • BKE12830 (Δ[gene|CD14C88E9976964A0D25BAA22C395A5A6951654D|spoIISA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCGAATCCCTCACAT, downstream forward: _UP4_ATTGAGGAGGAAGGTGAAGG
  • BKK12830 (Δ[gene|CD14C88E9976964A0D25BAA22C395A5A6951654D|spoIISA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCGAATCCCTCACAT, downstream forward: _UP4_ATTGAGGAGGAAGGTGAAGG
  • References

    Reviews

  • 31075979
  • Original publications

  • 18096016,11371520,21147767,25039482,20863891,26300872,27294956