SubtiBank SubtiBank
rocF
You are currently viewing an outdated version of SubtiWiki. Please use the newest version!

rocF

arginase
locus
BSU_40320
pI
4.93
mw
32.00 kDa
protein length
296 aa Sequence Blast
gene length
891 bp Sequence Blast
function
arginine utilization
product
arginase
essential
no
ec
3.5.3.1
synonyms
RocF

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.4|Utilization of arginine/ ornithine]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    Coordinates
    4,141,711 → 4,142,601

    The protein

    Catalyzed reaction/ biological activity

  • H2O + L-arginine --> L-ornithine + urea (according to UniProt)
  • Protein family

  • arginase family (with [protein|EA0AA0ECBC4A36A3F01F5876900FE51243D9AD07|SpeB] and [protein|FBB15E07B7134C57208EA82D5339708385DBC5FB|HutG], according to UniProt)
  • Modification

  • phosphorylated on Ser-68 [Pubmed|20509597]
  • Structure

  • [PDB|6NFP]
  • [PDB|6DKT]
  • Biological materials

    Mutant

  • GP655, aphA3, available in the [SW|Stülke] lab
  • BKE40320 (Δ[gene|CD121BBF1DC206D1189ECF8B32456641A55C41D4|rocF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTGATTCCACCTCAA, downstream forward: _UP4_TAATAAGAAAACCCCCGCAC
  • BKK40320 (Δ[gene|CD121BBF1DC206D1189ECF8B32456641A55C41D4|rocF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTGATTCCACCTCAA, downstream forward: _UP4_TAATAAGAAAACCCCCGCAC
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • References

  • 12618455,20509597,14651647,12618455,7540694,23625224,10196128