SubtiBank SubtiBank
rocF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rocF

arginase
locus
BSU40320
pI
4.93
mw
32.00 kDa
protein length
296 aa Sequence Blast
gene length
891 bp Sequence Blast
function
arginine utilization
product
arginase
essential
no
ec
3.5.3.1
synonyms
RocF

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.4|Utilization of arginine/ ornithine]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    Coordinates
    4,141,711 → 4,142,601

    The protein

    Catalyzed reaction/ biological activity

  • L-arginine + H2O = L-ornithine + urea (according to Swiss-Prot)
  • Protein family

  • arginase family (according to Swiss-Prot)
  • Modification

  • phosphorylated on Ser-68 [Pubmed|20509597]
  • Structure

  • [PDB|6NFP]
  • [PDB|6DKT]
  • Expression and Regulation

    Operons

    genes
    [gene|617FE9E40E8822D58B0446128585CB6CA05A50C6|rocD]-[gene|B46A8BCEC56E6252712E30F8BF8DA6B836FDE2F6|rocE]-[gene|CD121BBF1DC206D1189ECF8B32456641A55C41D4|rocF]
    description
    [Pubmed|7540694]

    sigma factors

  • [protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL]: sigma factor, [Pubmed|7540694], in [regulon|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC]: activation, [Pubmed|7540694], in [regulon|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|BEE6F16D6A5BBC7FED9E8EB5FA6A94BBF932BBDA|RocR]: activation, [Pubmed|7540694], in [regulon|BEE6F16D6A5BBC7FED9E8EB5FA6A94BBF932BBDA|RocR regulon]
  • regulation

  • induced by arginine ([protein|search|RocR], [protein|search|AhrC]) [Pubmed|7540694]
  • additional information

  • expression of the ''[protein|search|rocD]-[protein|search|rocE]-[protein|search|rocF]'' operon is increased upon depletion of ''[SW|nusA]'' (resulting from increased ''[SW|ahrC]'' expression) [http://www.nature.com/articles/nmicrobiol20157 Reference]
  • view in new tab

    Biological materials

    Mutant

  • GP655, aphA3, available in the [SW|Stülke] lab
  • BKE40320 (Δ[gene|CD121BBF1DC206D1189ECF8B32456641A55C41D4|rocF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTGATTCCACCTCAA, downstream forward: _UP4_TAATAAGAAAACCCCCGCAC
  • BKK40320 (Δ[gene|CD121BBF1DC206D1189ECF8B32456641A55C41D4|rocF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTGATTCCACCTCAA, downstream forward: _UP4_TAATAAGAAAACCCCCGCAC
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • References

  • 12618455,20509597,14651647,12618455,7540694,23625224,10196128