SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


32.00 kDa
protein length
296 aa Sequence Blast
gene length
891 bp Sequence Blast
arginine utilization

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW|Utilization of arginine/ ornithine]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    4,141,711 → 4,142,601

    The protein

    Catalyzed reaction/ biological activity

  • H2O + L-arginine --> L-ornithine + urea (according to UniProt)
  • Protein family

  • arginase family (with [protein|EA0AA0ECBC4A36A3F01F5876900FE51243D9AD07|SpeB] and [protein|FBB15E07B7134C57208EA82D5339708385DBC5FB|HutG], according to UniProt)
  • Modification

  • phosphorylated on Ser-68 [Pubmed|20509597]
  • Structure

  • [PDB|6NFP]
  • [PDB|6DKT]
  • Expression and Regulation



    sigma factors

  • [protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL]: sigma factor, [Pubmed|7540694], in [regulon|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC]: activation, [Pubmed|7540694], in [regulon|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|BEE6F16D6A5BBC7FED9E8EB5FA6A94BBF932BBDA|RocR]: activation, [Pubmed|7540694], in [regulon|BEE6F16D6A5BBC7FED9E8EB5FA6A94BBF932BBDA|RocR regulon]
  • regulation

  • induced by arginine ([protein|search|RocR], [protein|search|AhrC]) [Pubmed|7540694]
  • additional information

  • expression of the ''[protein|search|rocD]-[protein|search|rocE]-[protein|search|rocF]'' operon is increased upon depletion of ''[SW|nusA]'' (resulting from increased ''[SW|ahrC]'' expression) [ Reference]
  • view in new tab

    Biological materials


  • GP655, aphA3, available in the [SW|Stülke] lab
  • BKE40320 (Δ[gene|CD121BBF1DC206D1189ECF8B32456641A55C41D4|rocF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTGATTCCACCTCAA, downstream forward: _UP4_TAATAAGAAAACCCCCGCAC
  • BKK40320 (Δ[gene|CD121BBF1DC206D1189ECF8B32456641A55C41D4|rocF]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTGATTCCACCTCAA, downstream forward: _UP4_TAATAAGAAAACCCCCGCAC
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • References

  • 12618455,20509597,14651647,12618455,7540694,23625224,10196128