SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


32.00 kDa
protein length
296 aa Sequence Blast
gene length
891 bp Sequence Blast
arginine utilization

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW|Utilization of arginine/ ornithine]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    4,141,711 → 4,142,601

    The protein

    Catalyzed reaction/ biological activity

  • H2O + L-arginine --> L-ornithine + urea (according to UniProt)
  • Protein family

  • arginase family (with [protein|EA0AA0ECBC4A36A3F01F5876900FE51243D9AD07|SpeB] and [protein|FBB15E07B7134C57208EA82D5339708385DBC5FB|HutG], according to UniProt)
  • Modification

  • phosphorylated on Ser-68 [Pubmed|20509597]
  • Structure

  • [PDB|6NFP]
  • [PDB|6DKT]
  • Expression and Regulation



    sigma factors

  • [protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL]: sigma factor, [Pubmed|7540694], in [regulon|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC]: activation, [Pubmed|7540694], in [regulon|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|BEE6F16D6A5BBC7FED9E8EB5FA6A94BBF932BBDA|RocR]: activation, [Pubmed|7540694], in [regulon|BEE6F16D6A5BBC7FED9E8EB5FA6A94BBF932BBDA|RocR regulon]
  • regulation

  • induced by arginine ([protein|search|RocR], [protein|search|AhrC]) [Pubmed|7540694]
  • additional information

  • expression of the ''[protein|search|rocD]-[protein|search|rocE]-[protein|search|rocF]'' operon is increased upon depletion of ''[SW|nusA]'' (resulting from increased ''[SW|ahrC]'' expression) [ Reference]
  • view in new tab

    Biological materials


  • GP655, aphA3, available in the [SW|Stülke] lab
  • BKE40320 (Δ[gene|CD121BBF1DC206D1189ECF8B32456641A55C41D4|rocF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTGATTCCACCTCAA, downstream forward: _UP4_TAATAAGAAAACCCCCGCAC
  • BKK40320 (Δ[gene|CD121BBF1DC206D1189ECF8B32456641A55C41D4|rocF]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTGATTCCACCTCAA, downstream forward: _UP4_TAATAAGAAAACCCCCGCAC
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • References

  • 12618455,20509597,14651647,12618455,7540694,23625224,10196128