SubtiBank SubtiBank
purS
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

purS

phosphoribosylformylglycinamidine synthase
locus
BSU_06460
pI
4.59
mw
9.62 kDa
protein length
gene length
255 bp Sequence Blast
function
purine biosynthesis
product
phosphoribosylformylglycinamidine synthase
essential
no
ec
6.3.5.3
synonyms
yexA

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.1|Biosynthesis/ acquisition of purine nucleotides]
  • Gene

    Coordinates
    702,319 → 702,573

    The protein

    Catalyzed reaction/ biological activity

  • ATP + H2O + L-glutamine + N2-formyl-N1-(5-phospho-D-ribosyl)glycinamide --> 2-(formamido)-N1-(5-phospho-D-ribosyl)acetamidine + ADP + H+ + L-glutamate + phosphate (according to UniProt)
  • Protein family

  • UPF0062 family (single member, according to UniProt)
  • Structure

  • [PDB|1T4A]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|1A9F7847AA1EB2A264842B44CD1B1A21F0AF6E57|purE]-[gene|0DA73E4D1935F6A91BE251EF2704A11DE5D81174|purK]-[gene|29FF54E2B9F4A11811F5E15885A4C02A259C7B35|purB]-[gene|447D12E940C7F45B6C5015844F9DED9D513CD6E5|purC]-[gene|CCD4DA969086181CFA33D6D241F2CAAE02E0C758|purS]-[gene|DEE856E83E790EB57F103F7A9156408AF090995D|purQ]-[gene|D34203FAA84C19B34B3CB5F00AC2E2663FFA344D|purL]-[gene|4AA5AF9C7CE8D0A9FD3A47650ECF130BCBEE1952|purF]-[gene|AD0DE9457D70DF02FA0F58867B24ABF236FAF65A|purM]-[gene|7B30F27D6C459437967A64467E52961F4A9E0F2C|purN]-[gene|54CE8EB2F5D1F9AEAA497E1F60248C9B2250B01E|purH]-[gene|9BBA22B09C6DD6C36E043D44B0F54BD0FFA5BA0E|purD]
    description
    [Pubmed|3036807]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|3036807], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|G-box|G-box]: termination, ([SW|riboswitch]) [pubmed|3036807,12787499], in [regulon|G-box|G-box]
  • [protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR]: repression, (molecular inducer: PRPP) [Pubmed|7638212,2536750], in [regulon|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR regulon]
  • regulation

  • expression activated by glucose (4.4 fold) [Pubmed|12850135]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A920 (yexA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/920 NBRP B. subtilis, Japan]
  • BKE06460 (Δ[gene|CCD4DA969086181CFA33D6D241F2CAAE02E0C758|purS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTAAGCTGACATAAACTT, downstream forward: _UP4_GAGGTTGAGGAGGTAGTCGC
  • BKK06460 (Δ[gene|CCD4DA969086181CFA33D6D241F2CAAE02E0C758|purS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTAAGCTGACATAAACTT, downstream forward: _UP4_GAGGTTGAGGAGGTAGTCGC
  • References

  • 15301532,15301530,10784038,3036807,7638212,15378759