SubtiBank SubtiBank
purS
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

purS

phosphoribosylformylglycinamidine synthase
locus
BSU06460
pI
4.59
mw
9.62 kDa
protein length
gene length
255 bp Sequence Blast
function
purine biosynthesis
product
phosphoribosylformylglycinamidine synthase
essential
no
ec
6.3.5.3
synonyms
yexA

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.1|Biosynthesis/ acquisition of purine nucleotides]
  • Gene

    Coordinates
    702,319 → 702,573

    The protein

    Protein family

  • UPF0062 family (according to Swiss-Prot)
  • Structure

  • [PDB|1T4A]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|1A9F7847AA1EB2A264842B44CD1B1A21F0AF6E57|purE]-[gene|0DA73E4D1935F6A91BE251EF2704A11DE5D81174|purK]-[gene|29FF54E2B9F4A11811F5E15885A4C02A259C7B35|purB]-[gene|447D12E940C7F45B6C5015844F9DED9D513CD6E5|purC]-[gene|CCD4DA969086181CFA33D6D241F2CAAE02E0C758|purS]-[gene|DEE856E83E790EB57F103F7A9156408AF090995D|purQ]-[gene|D34203FAA84C19B34B3CB5F00AC2E2663FFA344D|purL]-[gene|4AA5AF9C7CE8D0A9FD3A47650ECF130BCBEE1952|purF]-[gene|AD0DE9457D70DF02FA0F58867B24ABF236FAF65A|purM]-[gene|7B30F27D6C459437967A64467E52961F4A9E0F2C|purN]-[gene|54CE8EB2F5D1F9AEAA497E1F60248C9B2250B01E|purH]-[gene|9BBA22B09C6DD6C36E043D44B0F54BD0FFA5BA0E|purD]
    description
    [Pubmed|3036807]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|3036807], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|G-box|G-box]: termination, ([SW|riboswitch]) [pubmed|3036807,12787499], in [regulon|G-box|G-box]
  • [protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR]: repression, (molecular inducer: PRPP) [Pubmed|7638212,2536750], in [regulon|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR regulon]
  • regulation

  • expression activated by glucose (4.4 fold) [Pubmed|12850135]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A920 (yexA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/920 NBRP B. subtilis, Japan]
  • BKE06460 (Δ[gene|CCD4DA969086181CFA33D6D241F2CAAE02E0C758|purS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTAAGCTGACATAAACTT, downstream forward: _UP4_GAGGTTGAGGAGGTAGTCGC
  • BKK06460 (Δ[gene|CCD4DA969086181CFA33D6D241F2CAAE02E0C758|purS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTAAGCTGACATAAACTT, downstream forward: _UP4_GAGGTTGAGGAGGTAGTCGC
  • References

  • 15301532,15301530,10784038,3036807,7638212,15378759