yfnI [2019-06-25 08:41:23]

polyglycerolphosphate lipoteichoic acid synthase, general stress protein, major secreted protein, required for survival at low temperature (4°C)

locus: BSU07260

pI: 5.95

mw: 73.14 kDa

protein length: 639 aa

gene length: 1920 bp

function: biosynthesis of lipoteichoic acid

product: minor lipoteichoic acid synthetase

essential: no

synonyms: yetP

Genomic Context

categories

• [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW 1.1.1.3|Biosynthesis of lipoteichoic acid]
• [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW 2.6.1.2|Biosynthesis of lipoteichoic acid]
• [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
• [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
• [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.8|Phosphorylation on either a Ser, Thr or Tyr residue]

Gene

Coordinates: 796,314 → 798,233

Phenotypes of a mutant

• induction of [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM] and [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX] activities [Pubmed|23103977]
• more sensitive to nisin [Pubmed|23980836]
• increased conjugation of ICEBs1 [Pubmed|25069588]
• suppression of the growth and morphology defects of a [gene|7150BABA5086D5E2EB8102E4901A216F43576282|glmR] mutant [pubmed|30478337]

The protein

Protein family

• LTA synthase family (according to Swiss-Prot)

Paralogous protein(s)

• [protein|2B33F2F9C2FB0767B72A29D060037393C88ACEE5|YqgS], [protein|418900B6DBDF3EF300C930B0C75E31B939F3CE00|LtaS], [protein|880C655DC7149F6EDC21BD2CF8F9F2C9FBEB2CDB|YvgJ]

Modification

• phosphorylation on (Thr-311 OR Ser-312) [Pubmed|17218307]
• can be phosphorylated by [protein|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|PrkC] on Thr-297 in vitro [pubmed|30478337]

Structure

• [PDB|2W5Q] ([protein|418900B6DBDF3EF300C930B0C75E31B939F3CE00|LtaS] from S. aureus, corresponds to aa 215 ... 632 of [protein|CCD06F344E3C87E77C3D13883CE2B927F372A84E|YfnI]) [pubmed|19168632]

[SW|Localization]

• extracellular (signal peptide) [Pubmed|18957862]

Expression and Regulation

Operons

• genes: [gene|CCD06F344E3C87E77C3D13883CE2B927F372A84E|yfnI]
  description: [Pubmed|22383849]

  sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|17434969], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]

  additional information

  • term-seq has identified a potential novel regulatory RNA element including an intrinsic transcription terminator upstream of ''yfnI'' [Pubmed|27120414]

Biological materials

Mutant

• MGNA-C226 (yfnI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2224 NBRP B. subtilis, Japan]
• SM-NB (''yfnI-spc''), available in [SW|Anne Galinier]'s and [SW|Boris Görke]'s labs
• GP1390 ''yfnI::spc'', available in [SW|Jörg Stülke]'s lab
• GP1397 ''yfnI::ermC'', available in [SW|Jörg Stülke]'s lab
• BKE07260 (Δ[gene|CCD06F344E3C87E77C3D13883CE2B927F372A84E|yfnI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCAACCTCTACTTTCT, downstream forward: _UP4_TAAGATGAAAAAGAGCCTTG
• BKK07260 (Δ[gene|CCD06F344E3C87E77C3D13883CE2B927F372A84E|yfnI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCAACCTCTACTTTCT, downstream forward: _UP4_TAAGATGAAAAAGAGCCTTG

References

Reviews

• 21388439,21255102

Original publications

• 17434969,18957862,17218307,19229300,21255105,23103977,23980836,25069588,27120414,19168632,30478337