SubtiBank SubtiBank
yfnI
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yfnI

polyglycerolphosphate lipoteichoic acid synthase, general stress protein, major secreted protein, required for survival at low temperature (4°C)
locus
BSU07260
pI
5.95
mw
73.14 kDa
protein length
639 aa Sequence Blast
gene length
1920 bp Sequence Blast
function
biosynthesis of lipoteichoic acid
product
minor lipoteichoic acid synthetase
essential
no
synonyms
yetP

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW 1.1.1.3|Biosynthesis of lipoteichoic acid]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW 2.6.1.2|Biosynthesis of lipoteichoic acid]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.8|Phosphorylation on either a Ser, Thr or Tyr residue]
  • Gene

    Coordinates
    796,314 → 798,233

    Phenotypes of a mutant

  • induction of [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM] and [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX] activities [Pubmed|23103977]
  • more sensitive to nisin [Pubmed|23980836]
  • increased conjugation of ICEBs1 [Pubmed|25069588]
  • suppression of the growth and morphology defects of a [gene|7150BABA5086D5E2EB8102E4901A216F43576282|glmR] mutant [pubmed|30478337]
  • The protein

    Protein family

  • LTA synthase family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|2B33F2F9C2FB0767B72A29D060037393C88ACEE5|YqgS], [protein|418900B6DBDF3EF300C930B0C75E31B939F3CE00|LtaS], [protein|880C655DC7149F6EDC21BD2CF8F9F2C9FBEB2CDB|YvgJ]
  • Modification

  • phosphorylation on (Thr-311 OR Ser-312) [Pubmed|17218307]
  • can be phosphorylated by [protein|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|PrkC] on Thr-297 in vitro [pubmed|30478337]
  • Structure

  • [PDB|2W5Q] ([protein|418900B6DBDF3EF300C930B0C75E31B939F3CE00|LtaS] from S. aureus, corresponds to aa 215 ... 632 of [protein|CCD06F344E3C87E77C3D13883CE2B927F372A84E|YfnI]) [pubmed|19168632]
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation

    Operons

    genes
    [gene|CCD06F344E3C87E77C3D13883CE2B927F372A84E|yfnI]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|17434969], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • additional information

  • term-seq has identified a potential novel regulatory RNA element including an intrinsic transcription terminator upstream of ''yfnI'' [Pubmed|27120414]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C226 (yfnI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2224 NBRP B. subtilis, Japan]
  • SM-NB (''yfnI-spc''), available in [SW|Anne Galinier]'s and [SW|Boris Görke]'s labs
  • GP1390 ''yfnI::spc'', available in [SW|Jörg Stülke]'s lab
  • GP1397 ''yfnI::ermC'', available in [SW|Jörg Stülke]'s lab
  • BKE07260 (Δ[gene|CCD06F344E3C87E77C3D13883CE2B927F372A84E|yfnI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCAACCTCTACTTTCT, downstream forward: _UP4_TAAGATGAAAAAGAGCCTTG
  • BKK07260 (Δ[gene|CCD06F344E3C87E77C3D13883CE2B927F372A84E|yfnI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCAACCTCTACTTTCT, downstream forward: _UP4_TAAGATGAAAAAGAGCCTTG
  • References

    Reviews

  • 21388439,21255102
  • Original publications

  • 17434969,18957862,17218307,19229300,21255105,23103977,23980836,25069588,27120414,19168632,30478337