SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


polyglycerolphosphate lipoteichoic acid synthase, general stress protein, major secreted protein, required for survival at low temperature (4°C)
73.14 kDa
protein length
639 aa Sequence Blast
gene length
1920 bp Sequence Blast
biosynthesis of lipoteichoic acid
minor lipoteichoic acid synthetase

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW|Biosynthesis of lipoteichoic acid]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW|Biosynthesis of lipoteichoic acid]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.8|Phosphorylation on either a Ser, Thr or Tyr residue]
  • Gene

    796,314 → 798,233

    Phenotypes of a mutant

  • induction of [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM] and [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX] activities [Pubmed|23103977]
  • more sensitive to nisin [Pubmed|23980836]
  • increased conjugation of ICEBs1 [Pubmed|25069588]
  • suppression of the growth and morphology defects of a [gene|7150BABA5086D5E2EB8102E4901A216F43576282|glmR] mutant [pubmed|30478337]
  • The protein

    Protein family

  • [SW|LTA synthase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|2B33F2F9C2FB0767B72A29D060037393C88ACEE5|YqgS], [protein|418900B6DBDF3EF300C930B0C75E31B939F3CE00|LtaS], [protein|880C655DC7149F6EDC21BD2CF8F9F2C9FBEB2CDB|YvgJ]
  • Modification

  • phosphorylation on (Thr-311 OR Ser-312) [Pubmed|17218307]
  • can be phosphorylated by [protein|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|PrkC] on Thr-297 in vitro [pubmed|30478337]
  • Structure

  • [PDB|2W5Q] ([protein|418900B6DBDF3EF300C930B0C75E31B939F3CE00|LtaS] from S. aureus, corresponds to aa 215 ... 632 of [protein|CCD06F344E3C87E77C3D13883CE2B927F372A84E|YfnI]) [pubmed|19168632]
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation



    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|17434969], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • additional information

  • term-seq has identified a potential novel regulatory RNA element including an intrinsic transcription terminator upstream of ''yfnI'' [Pubmed|27120414]
  • view in new tab

    Biological materials


  • MGNA-C226 (yfnI::erm), available at the [ NBRP B. subtilis, Japan]
  • SM-NB (''yfnI-spc''), available in [SW|Anne Galinier]'s and [SW|Boris Görke]'s labs
  • GP1390 ''yfnI::spc'', available in [SW|Jörg Stülke]'s lab
  • GP1397 ''yfnI::ermC'', available in [SW|Jörg Stülke]'s lab
  • BKE07260 (Δ[gene|CCD06F344E3C87E77C3D13883CE2B927F372A84E|yfnI]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCAACCTCTACTTTCT, downstream forward: _UP4_TAAGATGAAAAAGAGCCTTG
  • BKK07260 (Δ[gene|CCD06F344E3C87E77C3D13883CE2B927F372A84E|yfnI]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCAACCTCTACTTTCT, downstream forward: _UP4_TAAGATGAAAAAGAGCCTTG
  • References


  • 21388439,21255102
  • Original publications

  • 17434969,18957862,17218307,19229300,21255105,23103977,23980836,25069588,27120414,19168632,30478337