SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


polyglycerolphosphate lipoteichoic acid synthase, general stress protein, major secreted protein, required for survival at low temperature (4°C)
73.14 kDa
protein length
639 aa Sequence Blast
gene length
1920 bp Sequence Blast
biosynthesis of lipoteichoic acid
minor lipoteichoic acid synthetase

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW|Biosynthesis of lipoteichoic acid]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW|Biosynthesis of lipoteichoic acid]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.8|Phosphorylation on either a Ser, Thr or Tyr residue]
  • Gene

    796,314 → 798,233

    Phenotypes of a mutant

  • induction of [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM] and [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX] activities [Pubmed|23103977]
  • more sensitive to nisin [Pubmed|23980836]
  • increased conjugation of ICEBs1 [Pubmed|25069588]
  • suppression of the growth and morphology defects of a [gene|7150BABA5086D5E2EB8102E4901A216F43576282|glmR] mutant [pubmed|30478337]
  • The protein

    Protein family

  • [SW|LTA synthase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|2B33F2F9C2FB0767B72A29D060037393C88ACEE5|YqgS], [protein|418900B6DBDF3EF300C930B0C75E31B939F3CE00|LtaS], [protein|880C655DC7149F6EDC21BD2CF8F9F2C9FBEB2CDB|YvgJ]
  • Modification

  • phosphorylation on (Thr-311 OR Ser-312) [Pubmed|17218307]
  • can be phosphorylated by [protein|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|PrkC] on Thr-297 in vitro [pubmed|30478337]
  • Structure

  • [PDB|2W5Q] ([protein|418900B6DBDF3EF300C930B0C75E31B939F3CE00|LtaS] from S. aureus, corresponds to aa 215 ... 632 of [protein|CCD06F344E3C87E77C3D13883CE2B927F372A84E|YfnI]) [pubmed|19168632]
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation



    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|17434969], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • additional information

  • term-seq has identified a potential novel regulatory RNA element including an intrinsic transcription terminator upstream of ''yfnI'' [Pubmed|27120414]
  • view in new tab

    Biological materials


  • MGNA-C226 (yfnI::erm), available at the [ NBRP B. subtilis, Japan]
  • SM-NB (''yfnI-spc''), available in [SW|Anne Galinier]'s and [SW|Boris Görke]'s labs
  • GP1390 ''yfnI::spc'', available in [SW|Jörg Stülke]'s lab
  • GP1397 ''yfnI::ermC'', available in [SW|Jörg Stülke]'s lab
  • BKE07260 (Δ[gene|CCD06F344E3C87E77C3D13883CE2B927F372A84E|yfnI]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCAACCTCTACTTTCT, downstream forward: _UP4_TAAGATGAAAAAGAGCCTTG
  • BKK07260 (Δ[gene|CCD06F344E3C87E77C3D13883CE2B927F372A84E|yfnI]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCAACCTCTACTTTCT, downstream forward: _UP4_TAAGATGAAAAAGAGCCTTG
  • References


  • 21388439,21255102
  • Original publications

  • 17434969,18957862,17218307,19229300,21255105,23103977,23980836,25069588,27120414,19168632,30478337