SubtiBank SubtiBank
yqaQ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqaQ

unknown
locus
BSU_26220
pI
9.39
mw
17.79 kDa
protein length
151 aa Sequence Blast
gene length
456 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    Coordinates
    2,690,989 → 2,691,444

    Biological materials

    Mutant

  • BKE26220 (Δ[gene|CCB3631C985BBD8ADA0A47E7284E3B178F7FE635|yqaQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAAAGTATCCTCCTTTT, downstream forward: _UP4_TAAAATGGGAGGCAGGTCGG
  • BKK26220 (Δ[gene|CCB3631C985BBD8ADA0A47E7284E3B178F7FE635|yqaQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAAAGTATCCTCCTTTT, downstream forward: _UP4_TAAAATGGGAGGCAGGTCGG
  • References

  • 27120414