SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


transcriptional regulator ([SW|LysR family]), activator of the [gene|7DA08C189F5524D4874E2F4828264AB2671A5460|ywbH]-[gene|2940E73F0BCAB69992BBD224402C95C2667757AD|ywbG] operon
34.52 kDa
protein length
301 aa Sequence Blast
gene length
906 bp Sequence Blast
control of expression of the [gene|7DA08C189F5524D4874E2F4828264AB2671A5460|ywbH]-[gene|2940E73F0BCAB69992BBD224402C95C2667757AD|ywbG] operon
transcriptional regulator ([SW|LysR family])

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factor/ other/ based on similarity]
  • Gene

    3,932,198 → 3,933,103

    The protein

    Protein family

  • [SW|LysR family] (according to UniProt)
  • [SW|Domains]

  • [SW|HTH lysR-type domain] (aa 1-58) (according to UniProt)
  • Effectors of protein activity

  • acetate activates [protein|CC55120C2AF455FA2AEAE39E21F57897B2B5BC39|YwbI] to bind DNA [Pubmed|26060272]
  • Structure

  • [PDB|3FZV] (from Pseudomonas aeruginosa, 28% identity)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9139923], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials


  • MGNA-B675 (ywbI::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE38310 (Δ[gene|CC55120C2AF455FA2AEAE39E21F57897B2B5BC39|ywbI]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCGCTTCACCCTTTCTA, downstream forward: _UP4_AAAGATAGTAAAGGATGATG
  • BKK38310 (Δ[gene|CC55120C2AF455FA2AEAE39E21F57897B2B5BC39|ywbI]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCGCTTCACCCTTTCTA, downstream forward: _UP4_AAAGATAGTAAAGGATGATG
  • References

  • 9139923,26060272