SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


flagellar basal-body rod protein, required for the assembly of the flagellar hook and filament
16.12 kDa
protein length
150 aa Sequence Blast
gene length
453 bp Sequence Blast
movement and chemotaxis
flagellar basal-body rod protein

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW|Flagellar proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    1,691,667 → 1,692,119

    Phenotypes of a mutant

  • defective in swarming and flagellar assembly [pubmed|30201778]
  • The protein

    Protein family

  • [SW|Flagella basal body rod proteins family] (according to UniProt)
  • [SW|Localization]

  • bacterial flagellum basal body (according to Swiss-Prot), extracellular (no signal peptide) [Pubmed|18957862]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9657996], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|9657996], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA]: activation, in [regulon|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: repression, in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials


  • BKE16190 (Δ[gene|CC423DE6481353699B0CD3A2B8BBC36967A832CC|flgC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTTAAGCTATGAAAAGCTG, downstream forward: _UP4_GAAATCGGAAAGTAGGTGAA
  • BKK16190 (Δ[gene|CC423DE6481353699B0CD3A2B8BBC36967A832CC|flgC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTTAAGCTATGAAAAGCTG, downstream forward: _UP4_GAAATCGGAAAGTAGGTGAA
  • References

  • 1905667,17850253,14651647,18957862,9657996,8157612,15175317,24386445,30201778