SubtiBank SubtiBank
atpB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

atpB

ATP synthase, part of the Fo complex (subunit a)
locus
BSU36870
pI
9.36
mw
26.90 kDa
protein length
244 aa Sequence Blast
gene length
735 bp Sequence Blast
function
ATP synthesis
product
ATP synthase (subunit a))
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.5|ATP synthesis] → [category|SW 2.1.5.1|ATPase]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,786,878 → 3,787,612

    The protein

    Catalyzed reaction/ biological activity

  • ATP synthesis [http://www.youtube.com/watch?v=uOoHKCMAUMc see a video]
  • Protein family

  • ATPase A chain family (according to Swiss-Prot)
  • Effectors of protein activity

  • ATPase activity is inhibited upon binding of Mg-ADP to [protein|2A566C2CF8F7B86E05EEF4B7A268E8C102070025|AtpD] [pubmed|30580998]
  • Structure

  • [PDB|5T4O] (ATPase from E. coli, 31% identity) [pubmed|28001127]
  • [SW|Localization]

  • membrane [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|8027AD5C3A92FB9B70E42C119FDEC697A64618C4|atpI]-[gene|CC1894D90AC17487A286B2909964916825055F93|atpB]-[gene|6CF7F6303425D8A51E1E01BF18823139E4259A8F|atpE]-[gene|87311FEA265AD3F5526C78D631E7E51BBF01F0D6|atpF]-[gene|E956A30D97B2941108880F3AD48620C4DB6E0EBD|atpH]-[gene|E3FADE979CE6AB6315F67812608FCE00CF4E2453|atpA]-[gene|492EEC8068043DA770F5DC1D54799C4366AE9A01|atpG]-[gene|2A566C2CF8F7B86E05EEF4B7A268E8C102070025|atpD]-[gene|A9DA64F8C7A60E8E2B1EDC99BEA1BD7DD0135AA6|atpC]
    description
    [Pubmed|9353933]

    regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • regulation

  • [protein|CEE73284EFC0DBE8870CE0B474922DED79475A57|RelA] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
  • the mRNA is processed between [gene|8027AD5C3A92FB9B70E42C119FDEC697A64618C4|atpI] and [gene|CC1894D90AC17487A286B2909964916825055F93|atpB] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • BKE36870 (Δ[gene|CC1894D90AC17487A286B2909964916825055F93|atpB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAGGGTTTTCACCTCTCT, downstream forward: _UP4_TAAAACATTATATCCAAACG
  • BKK36870 (Δ[gene|CC1894D90AC17487A286B2909964916825055F93|atpB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAGGGTTTTCACCTCTCT, downstream forward: _UP4_TAAAACATTATATCCAAACG
  • References

    Reviews

  • 23356252,23341301,23267178,22822068,21524994,19489730,17208001,16730323
  • Original publications

  • 7961438,18763711,10580496,28001127,29794222,30580998