SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


bactofilin, required for flagellar hook- and filament assembly
24.57 kDa
protein length
237 aa Sequence Blast
gene length
714 bp Sequence Blast
assembly of the flagellar hook and filament
yzdA, ygaT

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW|Flagellar proteins]
  • Gene

    971,374 → 972,087

    Phenotypes of a mutant

  • complete loss of swimming motility [Pubmed|26517549]
  • The protein

    Paralogous protein(s)

  • [protein|A283DF56E47D601004F660809AB7BD32C644D422|YhbF]
  • [SW|Localization]

  • discrete assemblies at the cell membrane [Pubmed|26517549]
  • assemblies are highly mobile [Pubmed|26517549]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A732 (yhbE::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE08950 (Δ[gene|CC0B2F230BD9F0F05B1DAF5BB2C92A9E30CDB5B7|yhbE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCCATTTATCACCAGCTTTT, downstream forward: _UP4_ACAAAGTTGTAAGGAGGATC
  • BKK08950 (Δ[gene|CC0B2F230BD9F0F05B1DAF5BB2C92A9E30CDB5B7|yhbE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCCATTTATCACCAGCTTTT, downstream forward: _UP4_ACAAAGTTGTAAGGAGGATC
  • References

  • 22383849,26517549