SubtiBank SubtiBank
yhbE
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yhbE

bactofilin, required for flagellar hook- and filament assembly
locus
BSU_08950
pI
4.82
mw
24.57 kDa
protein length
237 aa Sequence Blast
gene length
714 bp Sequence Blast
function
assembly of the flagellar hook and filament
product
bactofilin
essential
no
synonyms
yzdA, ygaT

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW 4.1.1.2|Flagellar proteins]
  • Gene

    Coordinates
    971,374 → 972,087

    Phenotypes of a mutant

  • complete loss of swimming motility [Pubmed|26517549]
  • The protein

    Paralogous protein(s)

  • [protein|A283DF56E47D601004F660809AB7BD32C644D422|YhbF]
  • [SW|Localization]

  • discrete assemblies at the cell membrane [Pubmed|26517549]
  • assemblies are highly mobile [Pubmed|26517549]
  • Expression and Regulation

    Operons

    genes
    [gene|FDA5363A4DB711CD799BEFF395D58072CD8FFC44|yhbD]-[gene|CC0B2F230BD9F0F05B1DAF5BB2C92A9E30CDB5B7|yhbE]-[gene|A283DF56E47D601004F660809AB7BD32C644D422|yhbF]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A732 (yhbE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/732 NBRP B. subtilis, Japan]
  • BKE08950 (Δ[gene|CC0B2F230BD9F0F05B1DAF5BB2C92A9E30CDB5B7|yhbE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCCATTTATCACCAGCTTTT, downstream forward: _UP4_ACAAAGTTGTAAGGAGGATC
  • BKK08950 (Δ[gene|CC0B2F230BD9F0F05B1DAF5BB2C92A9E30CDB5B7|yhbE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCCATTTATCACCAGCTTTT, downstream forward: _UP4_ACAAAGTTGTAAGGAGGATC
  • References

  • 22383849,26517549