SubtiBank SubtiBank
yqgQ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqgQ

putative single-stranded nucleic acid binding protein
locus
BSU_24860
pI
5.14
mw
8.48 kDa
protein length
gene length
216 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    2,571,582 → 2,571,797

    The protein

    Structure

  • [PDB|2NN4] [Pubmed|20057058]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Biological materials

    Mutant

  • BKE24860 (Δ[gene|CC0467F20FD53BD5291387CFAA8D79171C246D1F|yqgQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCCTCACCATTTCTT, downstream forward: _UP4_TTTTATAAAGGCTAAGGTGA
  • BKK24860 (Δ[gene|CC0467F20FD53BD5291387CFAA8D79171C246D1F|yqgQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCCTCACCATTTCTT, downstream forward: _UP4_TTTTATAAAGGCTAAGGTGA
  • References

  • 15050034,20057058