SubtiBank SubtiBank
yqgA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqgA

unknown, genetically related to the cell wall-degrading dl-endopeptidases
locus
BSU_25050
pI
10.23
mw
15.14 kDa
protein length
142 aa Sequence Blast
gene length
429 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,587,996 → 2,588,424

    The protein

    [SW|Localization]

  • attached to the cell wall [Pubmed|25130749]
  • localized at [SW|cell division] sites during the transition period between the exponential and the stationary phases [Pubmed|25130749]
  • cell wall(according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|CBE6B495E934C5043C35DDA6E667ACFE1090B20E|yqgA]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C487 (yqgA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2485 NBRP B. subtilis, Japan]
  • BKE25050 (Δ[gene|CBE6B495E934C5043C35DDA6E667ACFE1090B20E|yqgA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTGTAGATCCTCCTTT, downstream forward: _UP4_TAACAGTTCAATAATGAGAA
  • BKK25050 (Δ[gene|CBE6B495E934C5043C35DDA6E667ACFE1090B20E|yqgA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTGTAGATCCTCCTTT, downstream forward: _UP4_TAACAGTTCAATAATGAGAA
  • References

  • 25130749,22383849