SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


16.52 kDa
protein length
148 aa Sequence Blast
gene length
447 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    1,946,249 → 1,946,695

    The protein

    Protein family

  • GtrA family (with [protein|FD30C4E458E63E8D6A932B351D4224F1AACD4B1B|GtcA], according to UniProt)
  • Structure

  • [PDB|5MLZ] (from Pyrococcus furiosus, 20% identity) [pubmed|28743912]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • regulatory mechanism

  • [protein|706983E6942E883D3A9D45693E7B4015AEABE60B|YclJ]: activation, [Pubmed|20512483], in [regulon|706983E6942E883D3A9D45693E7B4015AEABE60B|YclJ regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials


  • MGNA-B395 (yngA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE18170 (Δ[gene|CBCBF948979D9D63CBA86A9ED865E43B1F85A0AD|yngA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTGTTGATATGGATT, downstream forward: _UP4_ATACAGGATCAGGAGTGAAG
  • BKK18170 (Δ[gene|CBCBF948979D9D63CBA86A9ED865E43B1F85A0AD|yngA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTGTTGATATGGATT, downstream forward: _UP4_ATACAGGATCAGGAGTGAAG
  • References

  • 20512483,27766092,28743912