SubtiBank SubtiBank
remB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

remB

involved in the activation of biofilm matrix biosynthetic operons, acts in parallel to [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR], [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB], and [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]
locus
BSU_00050
pI
8.80
mw
5.80 kDa
protein length
gene length
246 bp Sequence Blast
function
regulation of [SW|biofilm formation]
product
regulator of the extracellular matrix
essential
no
synonyms
yaaB

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.5|Other proteins required for biofilm formation]
  • Gene

    Coordinates
    4,567 → 4,812

    Phenotypes of a mutant

  • smooth colonies on MsGG medium, no [SW|biofilm formation] [Pubmed|22113911]
  • Expression and Regulation

    Operons

    genes
    [gene|FB1C21A94697E5B9D29C0F3B9C9F36E57BCBD237|yaaA]-[gene|EBE03AEC7EC594A3115A7A72194BDFF300AA0BFA|recF]-[gene|CBC76FB453569550F14FE5015C05D45985C04979|remB]-[gene|AA42910B71348EFEA4165CFFCEF1E497897B9DDC|gyrB]-[gene|B207C7328177924B16F1C606F667BEADF12CA069|gyrA]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2987848], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B880 (yaaB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1879 NBRP B. subtilis, Japan]
  • BKE00050 (Δ[gene|CBC76FB453569550F14FE5015C05D45985C04979|remB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATACAATTGCTCACCTCATT, downstream forward: _UP4_TAGAAATTTTTTATCACGAA
  • BKK00050 (Δ[gene|CBC76FB453569550F14FE5015C05D45985C04979|remB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATACAATTGCTCACCTCATT, downstream forward: _UP4_TAGAAATTTTTTATCACGAA
  • labs

  • [SW|Daniel Kearns], Indiana University, Bloomington, USA, [http://www.bio.indiana.edu/facultyresearch/faculty/Kearns.html homepage]
  • References

  • 2987848,19363116