SubtiBank SubtiBank
remB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

remB

involved in the activation of biofilm matrix biosynthetic operons, acts in parallel to [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR], [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB], and [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]
locus
BSU_00050
pI
8.80
mw
5.80 kDa
protein length
gene length
246 bp Sequence Blast
function
regulation of [SW|biofilm formation]
product
regulator of the extracellular matrix
essential
no
synonyms
yaaB

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.5|Other proteins required for biofilm formation]
  • Gene

    Coordinates
    4,567 → 4,812

    Phenotypes of a mutant

  • smooth colonies on MsGG medium, no [SW|biofilm formation] [Pubmed|22113911]
  • Expression and Regulation

    Operons

    genes
    [gene|FB1C21A94697E5B9D29C0F3B9C9F36E57BCBD237|yaaA]-[gene|EBE03AEC7EC594A3115A7A72194BDFF300AA0BFA|recF]-[gene|CBC76FB453569550F14FE5015C05D45985C04979|remB]-[gene|AA42910B71348EFEA4165CFFCEF1E497897B9DDC|gyrB]-[gene|B207C7328177924B16F1C606F667BEADF12CA069|gyrA]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2987848], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B880 (yaaB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1879 NBRP B. subtilis, Japan]
  • BKE00050 (Δ[gene|CBC76FB453569550F14FE5015C05D45985C04979|remB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATACAATTGCTCACCTCATT, downstream forward: _UP4_TAGAAATTTTTTATCACGAA
  • BKK00050 (Δ[gene|CBC76FB453569550F14FE5015C05D45985C04979|remB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATACAATTGCTCACCTCATT, downstream forward: _UP4_TAGAAATTTTTTATCACGAA
  • labs

  • [SW|Daniel Kearns], Indiana University, Bloomington, USA, [http://www.bio.indiana.edu/facultyresearch/faculty/Kearns.html homepage]
  • References

  • 2987848,19363116