SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


involved in the activation of biofilm matrix biosynthetic operons, acts in parallel to [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR], [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB], and [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]
5.80 kDa
protein length
gene length
246 bp Sequence Blast
regulation of [SW|biofilm formation]
regulator of the extracellular matrix

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Other proteins required for biofilm formation]
  • Gene

    4,567 → 4,812

    Phenotypes of a mutant

  • smooth colonies on MsGG medium, no [SW|biofilm formation] [Pubmed|22113911]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2987848], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials


  • MGNA-B880 (yaaB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE00050 (Δ[gene|CBC76FB453569550F14FE5015C05D45985C04979|remB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATACAATTGCTCACCTCATT, downstream forward: _UP4_TAGAAATTTTTTATCACGAA
  • BKK00050 (Δ[gene|CBC76FB453569550F14FE5015C05D45985C04979|remB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATACAATTGCTCACCTCATT, downstream forward: _UP4_TAGAAATTTTTTATCACGAA
  • labs

  • [SW|Daniel Kearns], Indiana University, Bloomington, USA, [ homepage]
  • References

  • 2987848,19363116