SubtiBank SubtiBank
opuCC [2017-11-24 13:57:55]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

opuCC [2017-11-24 13:57:55]

glycine betaine/carnitine/choline ABC transporter (binding protein)
locus
BSU33810
pI
5.69
mw
33.80 kDa
protein length
303 aa Sequence Blast
gene length
909 bp Sequence Blast
function
compatible solute transport
product
glycine betaine/carnitine/choline ABC transporter (binding protein)
essential
no
synonyms
yvbC

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.4|Uptake of compatible solutes for osmoprotection]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.6|Coping with hyper-osmotic stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,468,253 → 3,469,164

    The protein

    Paralogous protein(s)

  • [protein|C48798FE13B1521236F5BC5786B9A02D7BC9A336|OpuBC]
  • Structure

  • [PDB|3PPN] [Pubmed|21366542]
  • [SW|Localization]

  • associated to the membrane (via [protein|83C45215AC86FACB08CF36EB5F9E6B076D7D0F0F|OpuCB]-[protein|76C8D6BF2CA1FA5E7392C52FFD55FD01EF5AB9DC|OpuCD]) [Pubmed|10092453]
  • lipoprotein [Pubmed|10216873]
  • Expression and Regulation

    Operons

    genes
    [gene|75DB6231129C28C5D3791BA43A1261CD46A861E8|opuCA]-[gene|83C45215AC86FACB08CF36EB5F9E6B076D7D0F0F|opuCB]-[gene|CBA6108A10AD8B932BC5B19A0E7982D0F56F1E08|opuCC]-[gene|76C8D6BF2CA1FA5E7392C52FFD55FD01EF5AB9DC|opuCD]
    description
    [Pubmed|10216873]

    regulatory mechanism

  • [protein|9F32E96AC9C32832C2F10FB125DDDC50EC9B546B|OpcR]: repression, [Pubmed|23960087], in [regulon|9F32E96AC9C32832C2F10FB125DDDC50EC9B546B|OpcR regulon]
  • [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA]: activation, [Pubmed|23646920], in [regulon|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA regulon]
  • [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR]: regulation, [pubmed|30355672], in [regulon|F4097349A563503468A2A14F062AEAC532C7917A|YlxR regulon]
  • regulation

  • induced by salt stress [Pubmed|23960087,10216873]
  • induced in the absence of [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR] [pubmed|30355672]
  • view in new tab

    Biological materials

    Mutant

  • BKE33810 (Δ[gene|CBA6108A10AD8B932BC5B19A0E7982D0F56F1E08|opuCC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTCATTTTCAACAGTGCCA, downstream forward: _UP4_GACTAAGAAAAGAGGTGGAT
  • BKK33810 (Δ[gene|CBA6108A10AD8B932BC5B19A0E7982D0F56F1E08|opuCC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTCATTTTCAACAGTGCCA, downstream forward: _UP4_GACTAAGAAAAGAGGTGGAT
  • References

    Reviews

  • 27935846
  • Original publications

  • 10092453,9925583,10216873,21296969,21366542,23960087,23646920,28256787