SubtiBank SubtiBank
yqgN
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqgN

similar to 5-formyltetrahydrofolate cyclo-ligase
locus
BSU_24890
pI
5.79
mw
21.27 kDa
protein length
187 aa Sequence Blast
gene length
564 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    2,573,760 → 2,574,323

    The protein

    Protein family

  • 5-formyltetrahydrofolate cyclo-ligase family (single member, according to UniProt)
  • Structure

  • [PDB|1YDM]
  • Biological materials

    Mutant

  • MGNA-C460 (yqgN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2458 NBRP B. subtilis, Japan]
  • BKE24890 (Δ[gene|CB9728D2A23C8F03104FF781D514CB3E6169835E|yqgN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCTCATCCCCCTCGGA, downstream forward: _UP4_TAACTTTCCTGTCCCTTATT
  • BKK24890 (Δ[gene|CB9728D2A23C8F03104FF781D514CB3E6169835E|yqgN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCTCATCCCCCTCGGA, downstream forward: _UP4_TAACTTTCCTGTCCCTTATT