SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to 5-formyltetrahydrofolate cyclo-ligase
21.27 kDa
protein length
187 aa Sequence Blast
gene length
564 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    2,573,760 → 2,574,323

    The protein

    Protein family

  • 5-formyltetrahydrofolate cyclo-ligase family (single member, according to UniProt)
  • Structure

  • [PDB|1YDM]
  • Biological materials


  • MGNA-C460 (yqgN::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE24890 (Δ[gene|CB9728D2A23C8F03104FF781D514CB3E6169835E|yqgN]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCTCATCCCCCTCGGA, downstream forward: _UP4_TAACTTTCCTGTCCCTTATT
  • BKK24890 (Δ[gene|CB9728D2A23C8F03104FF781D514CB3E6169835E|yqgN]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCTCATCCCCCTCGGA, downstream forward: _UP4_TAACTTTCCTGTCCCTTATT