SubtiBank SubtiBank
yxlA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yxlA

similar to purine-cytosine permease
locus
BSU_38710
pI
9.73
mw
50.35 kDa
protein length
457 aa Sequence Blast
gene length
1374 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.6|Nucleotide/ nucleoside transporter]
  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.6|Biosynthesis/ acquisition of nucleotides/ other/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,971,060 → 3,972,433

    The protein

    Protein family

  • purine-cytosine permease (2.A.39) family (with [protein|5681A5F186AD4B8C81B78FD9DDAE2C0624BE7CAF|PucI], according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|CB969A2D60F106466605052299F2A5FF5A20E9ED|yxlA]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B750 (yxlA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1749 NBRP B. subtilis, Japan]
  • BKE38710 (Δ[gene|CB969A2D60F106466605052299F2A5FF5A20E9ED|yxlA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGCATCGTCCTCCATAT, downstream forward: _UP4_TCTCTCTGAAGACAGCTTTT
  • BKK38710 (Δ[gene|CB969A2D60F106466605052299F2A5FF5A20E9ED|yxlA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGCATCGTCCTCCATAT, downstream forward: _UP4_TCTCTCTGAAGACAGCTTTT