SubtiBank SubtiBank
yxlA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yxlA

similar to purine-cytosine permease
locus
BSU38710
pI
9.73
mw
50.35 kDa
protein length
457 aa Sequence Blast
gene length
1374 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.6|Nucleotide/ nucleoside transporter]
  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.6|Biosynthesis/ acquisition of nucleotides/ other/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,971,060 → 3,972,433

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|CB969A2D60F106466605052299F2A5FF5A20E9ED|yxlA]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B750 (yxlA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1749 NBRP B. subtilis, Japan]
  • BKE38710 (Δ[gene|CB969A2D60F106466605052299F2A5FF5A20E9ED|yxlA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGCATCGTCCTCCATAT, downstream forward: _UP4_TCTCTCTGAAGACAGCTTTT
  • BKK38710 (Δ[gene|CB969A2D60F106466605052299F2A5FF5A20E9ED|yxlA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGCATCGTCCTCCATAT, downstream forward: _UP4_TCTCTCTGAAGACAGCTTTT