SubtiBank SubtiBank
icd
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

icd

isocitrate dehydrogenase
locus
BSU29130
pI
4.83
mw
46.26 kDa
protein length
423 aa Sequence Blast
gene length
1272 bp Sequence Blast
function
TCA cycle
product
isocitrate dehydrogenase
essential
no
ec
1.1.1.42
synonyms
citC

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.4|TCA cycle]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.8|Phosphorylation on either a Ser, Thr or Tyr residue]
  • Gene

    Coordinates
    2,979,716 → 2,980,987

    Phenotypes of a mutant

  • reduced ability to sporulate [Pubmed|9244258]
  • growth and sporulation defects of the mutant could be partially bypassed by deletion of the major citrate synthase gene (''[gene|58E3A065A95D03B4FB1F544906F53D1704D29EAD|citZ]'') [Pubmed|10348849]
  • The protein

    Catalyzed reaction/ biological activity

  • Isocitrate + NADP+ = 2-oxoglutarate + CO2 + NADPH (according to Swiss-Prot)
  • Protein family

  • Isocitrate and isopropylmalate dehydrogenases family (with [protein|105E3452D7F142A7D7616E35AF3FB753C9B63E38|LeuB] and [protein|E9D1B04FCB24402B56DC6A6F7AD696209E4BD0FA|YcsA], according to UniProt)
  • Paralogous protein(s)

  • [protein|E9D1B04FCB24402B56DC6A6F7AD696209E4BD0FA|YcsA]
  • Modification

  • phosphorylated on Arg-180 [Pubmed|22517742]
  • phosphorylated [Pubmed|17726680], [Pubmed|16493705]
  • ''in vitro'' phosphorylated by [protein|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|PrkC] on Thr-138, Thr-147, and Thr-396 [Pubmed|20389117]
  • [SW|Cofactors]

  • Mg2+, Mn2+, NADP+
  • Effectors of protein activity

  • Inhibited by glyoxylate, oxaloacetate and oxalomalate [Pubmed|4147570]
  • Structure

  • [PDB|1HQS] [pubmed|11290745]
  • Additional information

  • This enzyme requires NADP+ exclusively. No activity was seen on the presence on NAD+ [Pubmed|4147570]
  • extensive information on the structure and enzymatic properties of Icd can be found at [http://www.proteopedia.org/wiki/index.php/Isocitrate_dehydrogenase Proteopedia]
  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|CB7D0E32C044D541CD966DC1F9DA489D518A7703|icd]-[gene|5832127A2D0BD4AF2E891C93DC7C45221055FFC5|mdh]
    description
    [Pubmed|8045899]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8045899], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [protein|FE15A41A58A8177280817CA3825764C39185021A|CcpC]: transcription repression [Pubmed|12100558], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|FE15A41A58A8177280817CA3825764C39185021A|CcpC]: repression, (molecular inducer: citrate) [Pubmed|10656796], in [regulon|FE15A41A58A8177280817CA3825764C39185021A|CcpC regulon]
  • regulation

  • ''[protein|search|citZ]'': catabolite repression ([protein|search|CcpA]) [Pubmed|12100558]
  • view in new tab

    genes
    [gene|58E3A065A95D03B4FB1F544906F53D1704D29EAD|citZ]-[gene|CB7D0E32C044D541CD966DC1F9DA489D518A7703|icd]-[gene|5832127A2D0BD4AF2E891C93DC7C45221055FFC5|mdh]
    description
    [Pubmed|8045899]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8045899], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [protein|FE15A41A58A8177280817CA3825764C39185021A|CcpC]: transcription repression [Pubmed|12100558], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|FE15A41A58A8177280817CA3825764C39185021A|CcpC]: repression, (molecular inducer: citrate) [Pubmed|10656796], in [regulon|FE15A41A58A8177280817CA3825764C39185021A|CcpC regulon]
  • [protein|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|CitB]: mRNA destabilization, upon citrate accumulation or iron limitation [Pubmed|23354745], in [regulon|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|CitB regulon]
  • regulation

  • ''[protein|58E3A065A95D03B4FB1F544906F53D1704D29EAD|CitZ]'': catabolite repression ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]) [Pubmed|12100558]
  • view in new tab

    Biological materials

    Mutant

  • GP666 (spc), GP672 (erm), available in [SW|Jörg Stülke]'s lab
  • 1A1000 ( ''icd''::''spec''), [Pubmed| ], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A1000&Search=1A1000 BGSC]
  • 1A999 ( ''icd''::''spec''), [Pubmed| ], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A999&Search=1A999 BGSC]
  • GP790 Δ(''[gene|58E3A065A95D03B4FB1F544906F53D1704D29EAD|citZ]-[gene|CB7D0E32C044D541CD966DC1F9DA489D518A7703|icd]-[gene|5832127A2D0BD4AF2E891C93DC7C45221055FFC5|mdh]'')::''kan'', available in [SW|Jörg Stülke]'s lab
  • GP2331 Δ(''[gene|58E3A065A95D03B4FB1F544906F53D1704D29EAD|citZ]-[gene|CB7D0E32C044D541CD966DC1F9DA489D518A7703|icd]-[gene|5832127A2D0BD4AF2E891C93DC7C45221055FFC5|mdh]'')::''kan'', Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'',available in [SW|Jörg Stülke]'s lab
  • GP2333 Δ(''[gene|58E3A065A95D03B4FB1F544906F53D1704D29EAD|citZ]-[gene|CB7D0E32C044D541CD966DC1F9DA489D518A7703|icd]-[gene|5832127A2D0BD4AF2E891C93DC7C45221055FFC5|mdh]'')::''lox72'', Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'', available in [SW|Jörg Stülke]'s lab
  • BKE29130 (Δ[gene|CB7D0E32C044D541CD966DC1F9DA489D518A7703|icd]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAATAAAAACCTCCCAGT, downstream forward: _UP4_TAAGCAAGGAAAAAGCCTAA
  • BKK29130 (Δ[gene|CB7D0E32C044D541CD966DC1F9DA489D518A7703|icd]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAATAAAAACCTCCCAGT, downstream forward: _UP4_TAAGCAAGGAAAAAGCCTAA
  • Expression vectors

  • pGP1121 (N-terminal Strep-tag, for [SW|SPINE], purification from ''B. subtilis'', in [SW|pGP380]) (available in [SW|Jörg Stülke]'s lab) [pubmed|20933603]
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • Antibody

  • available in [SW|Linc Sonenshein]'s lab
  • labs

  • [SW| Linc Sonenshein], Tufts University, Boston, MA, USA [http://www.tufts.edu/sackler/microbiology/faculty/sonenshein/index.html Homepage]
  • References

  • 10656796,12850135,11290745,10348849,11751849,18763711,17726680,16493705,4147570,20389117,9244258,20933603,22517742,24325460,24571712,15378759,24616559,29546354