SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


isocitrate dehydrogenase
46.26 kDa
protein length
423 aa Sequence Blast
gene length
1272 bp Sequence Blast
TCA cycle
isocitrate dehydrogenase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW|TCA cycle]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.8|Phosphorylation on either a Ser, Thr or Tyr residue]
  • Gene

    2,979,716 → 2,980,987

    Phenotypes of a mutant

  • reduced ability to sporulate [Pubmed|9244258]
  • growth and sporulation defects of the mutant could be partially bypassed by deletion of the major citrate synthase gene (''[gene|58E3A065A95D03B4FB1F544906F53D1704D29EAD|citZ]'') [Pubmed|10348849]
  • The protein

    Catalyzed reaction/ biological activity

  • isocitrate + NADP+ --> 2-oxoglutarate + CO2 + NADPH (according to UniProt)
  • Protein family

  • Isocitrate and isopropylmalate dehydrogenases family (with [protein|105E3452D7F142A7D7616E35AF3FB753C9B63E38|LeuB] and [protein|E9D1B04FCB24402B56DC6A6F7AD696209E4BD0FA|YcsA], according to UniProt)
  • Paralogous protein(s)

  • [protein|E9D1B04FCB24402B56DC6A6F7AD696209E4BD0FA|YcsA]
  • Modification

  • phosphorylated on Arg-180 [Pubmed|22517742]
  • phosphorylated [Pubmed|17726680], [Pubmed|16493705]
  • ''in vitro'' phosphorylated by [protein|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|PrkC] on Thr-138, Thr-147, and Thr-396 [Pubmed|20389117]
  • [SW|Cofactors]

  • Mg2+, Mn2+, NADP+
  • Effectors of protein activity

  • Inhibited by glyoxylate, oxaloacetate and oxalomalate [Pubmed|4147570]
  • Structure

  • [PDB|1HQS] [pubmed|11290745]
  • Additional information

  • This enzyme requires NADP+ exclusively. No activity was seen on the presence on NAD+ [Pubmed|4147570]
  • extensive information on the structure and enzymatic properties of Icd can be found at [ Proteopedia]
  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8045899], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [protein|FE15A41A58A8177280817CA3825764C39185021A|CcpC]: transcription repression [Pubmed|12100558], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|FE15A41A58A8177280817CA3825764C39185021A|CcpC]: repression, (molecular inducer: citrate) [Pubmed|10656796], in [regulon|FE15A41A58A8177280817CA3825764C39185021A|CcpC regulon]
  • regulation

  • ''[protein|search|citZ]'': catabolite repression ([protein|search|CcpA]) [Pubmed|12100558]
  • view in new tab


    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8045899], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [protein|FE15A41A58A8177280817CA3825764C39185021A|CcpC]: transcription repression [Pubmed|12100558], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|FE15A41A58A8177280817CA3825764C39185021A|CcpC]: repression, (molecular inducer: citrate) [Pubmed|10656796], in [regulon|FE15A41A58A8177280817CA3825764C39185021A|CcpC regulon]
  • [protein|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|CitB]: mRNA destabilization, upon citrate accumulation or iron limitation [Pubmed|23354745], in [regulon|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|CitB regulon]
  • regulation

  • ''[protein|58E3A065A95D03B4FB1F544906F53D1704D29EAD|CitZ]'': catabolite repression ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]) [Pubmed|12100558]
  • view in new tab

    Biological materials


  • GP666 (spc), GP672 (erm), available in [SW|Jörg Stülke]'s lab
  • 1A1000 ( ''icd''::''spec''), [Pubmed| ], available at [ BGSC]
  • 1A999 ( ''icd''::''spec''), [Pubmed| ], available at [ BGSC]
  • GP790 Δ(''[gene|58E3A065A95D03B4FB1F544906F53D1704D29EAD|citZ]-[gene|CB7D0E32C044D541CD966DC1F9DA489D518A7703|icd]-[gene|5832127A2D0BD4AF2E891C93DC7C45221055FFC5|mdh]'')::''kan'', available in [SW|Jörg Stülke]'s lab
  • GP2331 Δ(''[gene|58E3A065A95D03B4FB1F544906F53D1704D29EAD|citZ]-[gene|CB7D0E32C044D541CD966DC1F9DA489D518A7703|icd]-[gene|5832127A2D0BD4AF2E891C93DC7C45221055FFC5|mdh]'')::''kan'', Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'',available in [SW|Jörg Stülke]'s lab
  • GP2333 Δ(''[gene|58E3A065A95D03B4FB1F544906F53D1704D29EAD|citZ]-[gene|CB7D0E32C044D541CD966DC1F9DA489D518A7703|icd]-[gene|5832127A2D0BD4AF2E891C93DC7C45221055FFC5|mdh]'')::''lox72'', Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'', available in [SW|Jörg Stülke]'s lab
  • BKE29130 (Δ[gene|CB7D0E32C044D541CD966DC1F9DA489D518A7703|icd]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAATAAAAACCTCCCAGT, downstream forward: _UP4_TAAGCAAGGAAAAAGCCTAA
  • BKK29130 (Δ[gene|CB7D0E32C044D541CD966DC1F9DA489D518A7703|icd]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAATAAAAACCTCCCAGT, downstream forward: _UP4_TAAGCAAGGAAAAAGCCTAA
  • Expression vectors

  • pGP1121 (N-terminal Strep-tag, for [SW|SPINE], purification from ''B. subtilis'', in [SW|pGP380]) (available in [SW|Jörg Stülke]'s lab) [pubmed|20933603]
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • Antibody

  • available in [SW|Linc Sonenshein]'s lab
  • labs

  • [SW| Linc Sonenshein], Tufts University, Boston, MA, USA [ Homepage]
  • References

  • 10656796,12850135,11290745,10348849,11751849,18763711,17726680,16493705,4147570,20389117,9244258,20933603,22517742,24325460,24571712,15378759,24616559,29546354