SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


24.73 kDa
protein length
235 aa Sequence Blast
gene length
708 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    2,739,486 → 2,740,193

    The protein

    Paralogous protein(s)

  • [protein|258DD30EA27B6A2E81B8359E43203C37F588037A|YncM]
  • Structure

  • [PDB|4HFS] (extracellular portion of [protein|258DD30EA27B6A2E81B8359E43203C37F588037A|YncM], 62% identity)
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation



    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • view in new tab

    Biological materials


  • MGNA-A868 (yrpD::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE26820 (Δ[gene|CB6300378FE7F14A9C7C664A533D73D513857FD7|yrpD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATTATTTCCCCCTATC, downstream forward: _UP4_TAAAACATGTTAAACATACA
  • BKK26820 (Δ[gene|CB6300378FE7F14A9C7C664A533D73D513857FD7|yrpD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATTATTTCCCCCTATC, downstream forward: _UP4_TAAAACATGTTAAACATACA
  • References

  • 18957862,20817675