SubtiBank SubtiBank
bofA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

bofA

inhibition of the pro-[protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigma-K] processing machinery
locus
BSU_00230
pI
9.32
mw
8.87 kDa
protein length
gene length
264 bp Sequence Blast
function
control of [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigma-K] activation
product
inhibitor of pro-[protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigma-K] processing
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW 3.4.1.2|Control of sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    29,772 → 30,035

    The protein

    [SW|Localization]

  • integral mother cell membrane protein [Pubmed|30403663,11959848]
  • Expression and Regulation

    Operons

    genes
    [gene|73D063EDC412F7F28DA27C986ECCCD1C4A1F6618|dnaX]-[gene|9AFCEFE83560B1E2B1FFD7CFD2E4F17FAE137889|yaaK]-[gene|BEBAF1EB53EBB3E7558BB5FE73C418B50000FA29|recR]-[gene|C5127208E7562F09249112240F0BE8C582B2E5AD|yaaL]-[gene|CB5D3A2E5BEE336539BEB2D7C5D9C3A63C78FD01|bofA]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|CB5D3A2E5BEE336539BEB2D7C5D9C3A63C78FD01|bofA]
    description
    [Pubmed|1315731]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|1315731], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: repression, [Pubmed|1315731], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed during sporulation [Pubmed|1315731]
  • additional information

  • the mRNA is very stable (half-life > 15 min) [http://www.ncbi.nlm.nih.gov/sites/entrez/12884008 PubMed]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A081 (bofA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/81 NBRP B. subtilis, Japan]
  • 1S100 ( ''bofA''::''cat''), [Pubmed|1577688], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S100&Search=1S100 BGSC]
  • 1S96 ( ''bofA''::''erm''), [Pubmed|1315731], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S96&Search=1S96 BGSC]
  • BKE00230 (Δ[gene|CB5D3A2E5BEE336539BEB2D7C5D9C3A63C78FD01|bofA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAATCTTCTCATCTCCT, downstream forward: _UP4_TAATTGATATTATGTATTGA
  • BKK00230 (Δ[gene|CB5D3A2E5BEE336539BEB2D7C5D9C3A63C78FD01|bofA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAATCTTCTCATCTCCT, downstream forward: _UP4_TAATTGATATTATGTATTGA
  • labs

  • Simon Cutting, London, UK [http://personal.rhul.ac.uk/uhba/009/bacillus/simon_cutting.html homepage]
  • References

    Reviews

  • 31350897
  • Original Publications

  • 11959848,9501233,1577688,15292188,2115401,12940997,12884008,15292188,1315731,15752199,16818230,15087499,30403663