SubtiBank SubtiBank
rasP
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rasP

intramembrane protease, cleaves [protein|79712F4CF884A660C71B45B3397AEFA5C0AFA683|FtsL], [protein|search|RsiV ]and [protein|4E720917045032E8B45CB8AF6E5C13AE0E48EE33|RsiW] as well as signal peptides after release of the secreted proteins
locus
BSU16560
pI
5.14
mw
46.58 kDa
protein length
422 aa Sequence Blast
gene length
1269 bp Sequence Blast
function
control of [SW|cell division], and [protein|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV] and [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW] activity
product
intramembrane protease
essential
no
synonyms
yluC

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.8|Cell division] → [category|SW 1.1.8.2|Other genes]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW 3.3.7.4|Additional proteins involved in proteolysis]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW 3.4.1.2|Control of sigma factors]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,724,029 → 1,725,297

    Phenotypes of a mutant

  • defects in competence development, [SW|protein secretion] and membrane protein production [Pubmed|23155385]
  • mutants grow slower in liquid, are not competent, can’t activate [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW], have [SW|cell division] defects, and decreased long term survival [Pubmed|23687273]
  • inactivation of ''[gene|CB50289535EA537F63BADD459BD11AA7759A6658|rasP]'' reduces sporulation efficiency to 1.4% that of wild type cells; delayed entry into sporulation; thin, oblong forespores [Pubmed|26735940]
  • The protein

    Catalyzed reaction/ biological activity

  • cleaves [protein|79712F4CF884A660C71B45B3397AEFA5C0AFA683|FtsL], [protein|ED1DDA187692683D9862EC0E858B80CD56C48045|RsiV] and [protein|4E720917045032E8B45CB8AF6E5C13AE0E48EE33|RsiW]
  • cleaves signal peptides after release of the secreted proteins [Pubmed|21810987]
  • Protein family

  • peptidase M50B family (according to Swiss-Prot)
  • [SW|Domains]

  • 4 transmembrane helices (aa 6 - 26, 175 - 195, 346 - 366, 394 - 414) (according to UniProt)
  • [SW|PDZ domain] (aa 190 - 268) (according to UniProt)
  • [SW|Localization]

  • cell membrane [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|58CDF08A8F05C0BC25EB6E400316F85FD0F307E5|ispC]-[gene|CB50289535EA537F63BADD459BD11AA7759A6658|rasP]-[gene|848570563D3C92A8E1E6AB4DA530388D8AE94E75|proS]-[gene|FB97DF0C147FB29944F60214CB9BC1803861DAA0|polC]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|4A637EB9B400D30E5C6246D1E0EB5E6A30F38A16|uppS]-[gene|7E7F6BBA03C443A5AFA05A6D9352FEF1212A5AF6|cdsA]-[gene|58CDF08A8F05C0BC25EB6E400316F85FD0F307E5|ispC]-[gene|CB50289535EA537F63BADD459BD11AA7759A6658|rasP]-[gene|848570563D3C92A8E1E6AB4DA530388D8AE94E75|proS]-[gene|FB97DF0C147FB29944F60214CB9BC1803861DAA0|polC]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE16560 (Δ[gene|CB50289535EA537F63BADD459BD11AA7759A6658|rasP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AACTGTATTCACGAACATAC, downstream forward: _UP4_TAAACGAAAAGTAAATCAAT
  • BKK16560 (Δ[gene|CB50289535EA537F63BADD459BD11AA7759A6658|rasP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AACTGTATTCACGAACATAC, downstream forward: _UP4_TAAACGAAAAGTAAATCAAT
  • References

    Reviews

  • 29343670
  • Original publications

  • 16899079,15130127,18599827,17020588,19889088,18763711,20644139,21810987,23687273,23155385,26735940,28376795,28674070