SubtiBank SubtiBank
rasP
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rasP

intramembrane protease, cleaves [protein|79712F4CF884A660C71B45B3397AEFA5C0AFA683|FtsL], [protein|search|RsiV ]and [protein|4E720917045032E8B45CB8AF6E5C13AE0E48EE33|RsiW] as well as signal peptides after release of the secreted proteins
locus
BSU_16560
pI
5.14
mw
46.58 kDa
protein length
422 aa Sequence Blast
gene length
1269 bp Sequence Blast
function
control of [SW|cell division], and [protein|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV] and [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW] activity
product
intramembrane protease
essential
no
synonyms
yluC

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.8|Cell division] → [category|SW 1.1.8.2|Other genes]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW 3.3.7.4|Additional proteins involved in proteolysis]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW 3.4.1.2|Control of sigma factors]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,724,029 → 1,725,297

    Phenotypes of a mutant

  • defects in competence development, [SW|protein secretion] and membrane protein production [Pubmed|23155385]
  • mutants grow slower in liquid, are not competent, can’t activate [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW], have [SW|cell division] defects, and decreased long term survival [Pubmed|23687273]
  • inactivation of ''[gene|CB50289535EA537F63BADD459BD11AA7759A6658|rasP]'' reduces sporulation efficiency to 1.4% that of wild type cells; delayed entry into sporulation; thin, oblong forespores [Pubmed|26735940]
  • The protein

    Catalyzed reaction/ biological activity

  • cleaves [protein|79712F4CF884A660C71B45B3397AEFA5C0AFA683|FtsL], [protein|ED1DDA187692683D9862EC0E858B80CD56C48045|RsiV] and [protein|4E720917045032E8B45CB8AF6E5C13AE0E48EE33|RsiW]
  • cleaves signal peptides after release of the secreted proteins [Pubmed|21810987]
  • Protein family

  • [SW|peptidase M50B family] (according to UniProt)
  • [SW|Domains]

  • 4 transmembrane helices (aa 6 - 26, 175 - 195, 346 - 366, 394 - 414) (according to UniProt)
  • [SW|PDZ domain] (aa 190 - 268) (according to UniProt)
  • [SW|Localization]

  • cell membrane [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|58CDF08A8F05C0BC25EB6E400316F85FD0F307E5|ispC]-[gene|CB50289535EA537F63BADD459BD11AA7759A6658|rasP]-[gene|848570563D3C92A8E1E6AB4DA530388D8AE94E75|proS]-[gene|FB97DF0C147FB29944F60214CB9BC1803861DAA0|polC]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|4A637EB9B400D30E5C6246D1E0EB5E6A30F38A16|uppS]-[gene|7E7F6BBA03C443A5AFA05A6D9352FEF1212A5AF6|cdsA]-[gene|58CDF08A8F05C0BC25EB6E400316F85FD0F307E5|ispC]-[gene|CB50289535EA537F63BADD459BD11AA7759A6658|rasP]-[gene|848570563D3C92A8E1E6AB4DA530388D8AE94E75|proS]-[gene|FB97DF0C147FB29944F60214CB9BC1803861DAA0|polC]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE16560 (Δ[gene|CB50289535EA537F63BADD459BD11AA7759A6658|rasP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AACTGTATTCACGAACATAC, downstream forward: _UP4_TAAACGAAAAGTAAATCAAT
  • BKK16560 (Δ[gene|CB50289535EA537F63BADD459BD11AA7759A6658|rasP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AACTGTATTCACGAACATAC, downstream forward: _UP4_TAAACGAAAAGTAAATCAAT
  • References

    Reviews

  • 29343670
  • Original publications

  • 16899079,15130127,18599827,17020588,19889088,18763711,20644139,21810987,23687273,23155385,26735940,28376795,28674070