SubtiBank SubtiBank
mtnU
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

mtnU

omega-amidase
locus
BSU13570
pI
5.10
mw
29.25 kDa
protein length
259 aa Sequence Blast
gene length
780 bp Sequence Blast
function
methionine salvage
product
omega-amidase
essential
no
synonyms
ykrU

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.10|Biosynthesis/ acquisition of methionine/ S-adenosylmethionine]
  • Gene

    Coordinates
    1,424,767 → 1,425,546

    Phenotypes of a mutant

  • reduced growth with 5-methylthioribose as single sulfur source [Pubmed|24837359]
  • The protein

    Catalyzed reaction/ biological activity

  • 2-ketoglutaramate + H2O --→ 2-oxoglutarate + NH3 [Pubmed|24837359]
  • Protein family

  • CN hydrolase domain (according to Swiss-Prot)
  • Structure

  • [PDB|3P8K] (from Staphylococcus aureus, 42% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|CB12BCCF6CEADC0C64DD918E0BAE4748E358A67B|mtnU]
    description
    [Pubmed|11545674]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12022921], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A784 (ykrU::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/784 NBRP B. subtilis, Japan]
  • BKE13570 (Δ[gene|CB12BCCF6CEADC0C64DD918E0BAE4748E358A67B|mtnU]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTTAACACCCCAAA, downstream forward: _UP4_TAAAAAATATATTGACAACT
  • BKK13570 (Δ[gene|CB12BCCF6CEADC0C64DD918E0BAE4748E358A67B|mtnU]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTTAACACCCCAAA, downstream forward: _UP4_TAAAAAATATATTGACAACT
  • References

  • 15102328,12022921,11545674,24837359