SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


beta-phosphoglucomutase/ glucose-1-phosphate phosphodismutase
24.95 kDa
protein length
226 aa Sequence Blast
gene length
681 bp Sequence Blast
starch and maltodextrin utilization
beta-phosphoglucomutase(EC and EC

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of starch/ maltodextrin]
  • Gene

    3,546,873 → 3,547,553

    The protein

    Catalyzed reaction/ biological activity

  • Beta-D-glucose 1-phosphate = beta-D-glucose 6-phosphate (according to Swiss-Prot)
  • Protein family

  • [SW|HAD superfamily]
  • CbbY/cbbZ/gph/yieH family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|345EC248C0ADF48B0C25B175241AAE982E0E9B78|YhdA]:
  • [protein|3DB9048B54C47E262997A2A5A0556AE607F93EA9|YhcW]:
  • Structure

  • [PDB|3NAS]
  • Expression and Regulation




  • induced in the presence of maltose [Pubmed|9573215]
  • view in new tab

    Biological materials


  • MGNA-B622 (yvdM::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE34550 (Δ[gene|CAFAE305B1771DD89E81F75A6713161393BE99A0|pgcM]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTCTAAATCAAAAATGACCG, downstream forward: _UP4_TGAAATGAAAAAAACCTGCA
  • BKK34550 (Δ[gene|CAFAE305B1771DD89E81F75A6713161393BE99A0|pgcM]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTCTAAATCAAAAATGACCG, downstream forward: _UP4_TGAAATGAAAAAAACCTGCA
  • References

  • 11081794,16707683