SubtiBank SubtiBank
pgcM
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

pgcM

beta-phosphoglucomutase/ glucose-1-phosphate phosphodismutase
locus
BSU_34550
pI
4.76
mw
24.95 kDa
protein length
226 aa Sequence Blast
gene length
681 bp Sequence Blast
function
starch and maltodextrin utilization
product
beta-phosphoglucomutase(EC 5.4.2.6 and EC 2.7.1.41)
essential
no
ec
5.4.2.6
synonyms
yvdM

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.23|Utilization of starch/ maltodextrin]
  • Gene

    Coordinates
    3,546,873 → 3,547,553

    The protein

    Catalyzed reaction/ biological activity

  • β-D-glucose 1-phosphate --> β-D-glucose 6-phosphate (according to UniProt)
  • Protein family

  • [SW|HAD superfamily] (according to UniProt)
  • CbbY/CbbZ/Gph/YieH family (with [protein|3DB9048B54C47E262997A2A5A0556AE607F93EA9|YhcW], according to UniProt)
  • Paralogous protein(s)

  • [protein|345EC248C0ADF48B0C25B175241AAE982E0E9B78|YhdA]:
  • [protein|3DB9048B54C47E262997A2A5A0556AE607F93EA9|YhcW]:
  • Structure

  • [PDB|3NAS]
  • Expression and Regulation

    Operons

    genes
    [gene|EA1BEC9FCFD2A32142A8A8E6D7362DB37E02052A|yvdE]-[gene|A577441DE4ABAF624D507DB80FBED2A652BCF385|yvdF]-[gene|5771E1976D986638B13ADDE97EDE32709E355923|mdxE]-[gene|EA2DD9892C1128ADCD6C8BC61248EBE45339E6D6|mdxF]-[gene|D72CFFE8ED3EC0280AE92C05A136D66ED1F62251|mdxG]-[gene|68C6FD5D4D9491EE15A5015447959A45C36EA702|yvdJ]-[gene|5F615BB886EC4F7000AAD42258DB8E47616552DE|yvdK]-[gene|6E5AB4620F9A896C32CD77AF314C67035814AE0A|malL]-[gene|CAFAE305B1771DD89E81F75A6713161393BE99A0|pgcM]
    description
    [Pubmed|16707683]

    regulation

  • induced in the presence of maltose [Pubmed|9573215]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B622 (yvdM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1621 NBRP B. subtilis, Japan]
  • BKE34550 (Δ[gene|CAFAE305B1771DD89E81F75A6713161393BE99A0|pgcM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTCTAAATCAAAAATGACCG, downstream forward: _UP4_TGAAATGAAAAAAACCTGCA
  • BKK34550 (Δ[gene|CAFAE305B1771DD89E81F75A6713161393BE99A0|pgcM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTCTAAATCAAAAATGACCG, downstream forward: _UP4_TGAAATGAAAAAAACCTGCA
  • References

  • 11081794,16707683