SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


methylcrotonoyl-CoA carboxylase
48.92 kDa
protein length
444 aa Sequence Blast
gene length
1335 bp Sequence Blast
mother cell metabolism, leucine utilization
methylcrotonoyl-CoA carboxylase, subunit

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW|Utilization of branched-chain amino acids]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • Gene

    1,953,181 → 1,954,515

    The protein

    Catalyzed reaction/ biological activity

  • ATP + hydrogencarbonate + N6-biotinyl-L-lysyl-[protein] --> ADP + H+ + N6-carboxybiotinyl-L-lysyl-[protein] + phosphate (according to UniProt)
  • acetyl-CoA + ATP + hydrogencarbonate --> ADP + H+ + malonyl-CoA + phosphate (according to UniProt)
  • [SW|Domains]

  • [SW|ATP-grasp domain] (aa 120-317) (according to UniProt)
  • Biotin carboxylation domain (aa 1-444) (according to UniProt)
  • [SW|Cofactors]

  • biotin
  • Structure

  • [PDB|1ULZ] (biotin carboxylase subunit of pyruvate carboxylase from Aquifex aeolicus, 52% identity) [Pubmed|14993673]
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,12662922], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|15699190,12662922]
  • view in new tab

    Biological materials


  • MGNA-B086 (yngH::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE18240 (Δ[gene|CAF58B4BAEB03353CF80A2862590888D07B48E2C|yngH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TACTTTTGTAAACATGATTT, downstream forward: _UP4_CACCTATAAAGGAGGCAGTT
  • BKK18240 (Δ[gene|CAF58B4BAEB03353CF80A2862590888D07B48E2C|yngH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TACTTTTGTAAACATGATTT, downstream forward: _UP4_CACCTATAAAGGAGGCAGTT
  • References

  • 15699190,12662922,19935659,14993673