SubtiBank SubtiBank
levE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

levE

fructose-specific permease of the [SW|phosphotransferase systems|phosphotransferase system], EIIB of the [category|SW 1.2.2|PTS], [category|SW 3.4.3|Trigger enzyme], control of [protein|1D2043CC0D8CF64142F0A5993A936C5A196726D4|LevR] activity
locus
BSU_27060
pI
9.44
mw
17.94 kDa
protein length
162 aa Sequence Blast
gene length
489 bp Sequence Blast
function
fructose uptake and phosphorylation, control of [protein|1D2043CC0D8CF64142F0A5993A936C5A196726D4|LevR] activity
product
fructose-specific [category|SW 1.2.2|PTS], EII component
essential
no
ec
2.7.1.69
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.2|Phosphotransferase system] → [category|SW 1.2.2.2|Sugar specific PTS proteins]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.27|Utilization of other polymeric carbohydrates]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.7|Utilization of fructose]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.4|Control of PRD-type regulators]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.3|Trigger enzyme] → [category|SW 3.4.3.1|Trigger enzymes of the PTS that control the activity of PRD-containing transcription factors]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    Coordinates
    2,761,907 → 2,762,395

    The protein

    Catalyzed reaction/ biological activity

  • D-fructose + Nπ-phospho-L-histidyl-[protein] --> D-fructose 1-phosphate + L-histidyl-[protein] (according to UniProt)
  • Protein family

  • [category|SW 1.2.2|PTS] permease, mannose family [Pubmed|10627040]
  • Structure

  • [PDB|1BLE]
  • [SW|Localization]

  • cytoplasm [pubmed|2117666]
  • Expression and Regulation

    Operons

    genes
    [gene|75C568C8F6912AC064B8B435975D52510D25466A|levD]-[gene|CAE38D8F25A5EC6AC8045E40072E6FEC632045FA|levE]-[gene|8ABA3735067C7AA433E09F219EE7239196377A95|levF]-[gene|F23B951F60A6A669D5BD86836906E0F4AD7A0C1B|levG]-[gene|61D5B957E018D019AE0CE1D5F6C6A33EF982ED49|sacC]
    description
    [Pubmed|2117666]

    sigma factors

  • [protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL]: sigma factor, [Pubmed|1924373], in [regulon|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|7592486], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|1D2043CC0D8CF64142F0A5993A936C5A196726D4|LevR]: activation, [Pubmed|1900939], in [regulon|1D2043CC0D8CF64142F0A5993A936C5A196726D4|LevR regulon]
  • regulation

  • induced in the presence of fructose ([protein|search|LevR]) [Pubmed|1900939]
  • view in new tab

    Biological materials

    Mutant

  • BKE27060 (Δ[gene|CAE38D8F25A5EC6AC8045E40072E6FEC632045FA|levE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATAATTCATCCTCTCT, downstream forward: _UP4_ACAAAATAATCAAGGGGATG
  • BKK27060 (Δ[gene|CAE38D8F25A5EC6AC8045E40072E6FEC632045FA|levE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATAATTCATCCTCTCT, downstream forward: _UP4_ACAAAATAATCAAGGGGATG
  • References

  • 10627040,2117666,9551099,9030753,9033408,1924373,7592486,1900939