SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


9.77 kDa
protein length
gene length
264 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    2,749,260 → 2,749,523

    The protein


  • secreted (according to Swiss-Prot)
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE26900 (Δ[gene|CADB90013B8CF7C229ED68240BBF9D2B9168920B|yraL]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTGCCAGCTCCTTAT, downstream forward: _UP4_TAAACAAAACGGAAGCACTG
  • BKK26900 (Δ[gene|CADB90013B8CF7C229ED68240BBF9D2B9168920B|yraL]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTGCCAGCTCCTTAT, downstream forward: _UP4_TAAACAAAACGGAAGCACTG