SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


negative regulation of [protein|801E92306971E26AD4AB155172B7F4EFDE2F9170|SigY]-directed transcription of the [gene|801E92306971E26AD4AB155172B7F4EFDE2F9170|sigY] operon
7.71 kDa
protein length
gene length
207 bp Sequence Blast
negative regulation of [protein|801E92306971E26AD4AB155172B7F4EFDE2F9170|SigY]-directed transcription of the [gene|801E92306971E26AD4AB155172B7F4EFDE2F9170|sigY] operon

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Control of sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    3,969,796 → 3,970,002

    Expression and Regulation



    sigma factors

  • [protein|801E92306971E26AD4AB155172B7F4EFDE2F9170|SigY]: sigma factor, [Pubmed|12897008], in [regulon|801E92306971E26AD4AB155172B7F4EFDE2F9170|SigY regulon]
  • view in new tab

    additional information

  • the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
  • Biological materials


  • MGNA-B759 (yxlD::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE38680 (Δ[gene|CAADFAFD4C39362D0D0F242C926AE101C683EB5D|yxlD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTCATCCGCGTTTCACCTC, downstream forward: _UP4_CAATGAATATTTCTTGGGAA
  • BKK38680 (Δ[gene|CAADFAFD4C39362D0D0F242C926AE101C683EB5D|yxlD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTCATCCGCGTTTCACCTC, downstream forward: _UP4_CAATGAATATTTCTTGGGAA
  • References

  • 14769884,12897008,26883633