SubtiBank SubtiBank
lonB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

lonB

Lon-like ATP-dependent protease
locus
BSU_28210
pI
6.27
mw
60.26 kDa
protein length
552 aa Sequence Blast
gene length
1659 bp Sequence Blast
function
protein quality control
product
Lon-like ATP-dependent protease
essential
no
synonyms
ysxF

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW 3.3.7.4|Additional proteins involved in proteolysis]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,882,971 → 2,884,629

    The protein

    Catalyzed reaction/ biological activity

  • Hydrolysis of proteins in presence of ATP (according to UniProt)
  • Protein family

  • Peptidase S16 family (with [protein|1A5C1BDE844AA56B90C0E4A02D74978676487E99|DdcP] and [protein|FF15BE26BCC78EC1301C58A51AF0A519D7BE9ADC|LonA], according to UniProt)
  • Structure

  • [PDB|3M6A] (C-terminal domain of [protein|FF15BE26BCC78EC1301C58A51AF0A519D7BE9ADC|LonA], 28% identity)
  • [SW|Localization]

  • localized to the forespore membrane early in development, followed by localization throughout the forespore later in development [Pubmed|18689473]
  • Expression and Regulation

    Operons

    genes
    [gene|CA90AAE5320C20F93F5ED0F167294C28495756FF|lonB]
    description
    [Pubmed|9852015]

    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325,11325926], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulation

  • expressed early during sporulation in the forespore ([protein|search|SigF]) [Pubmed|16497325,11325926]
  • view in new tab

    Biological materials

    Mutant

  • BKE28210 (Δ[gene|CA90AAE5320C20F93F5ED0F167294C28495756FF|lonB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28210 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTGGTCCCTCCTGAAA, downstream forward: _UP4_TAAACCCTATTTTGATAATA
  • BKK28210 (Δ[gene|CA90AAE5320C20F93F5ED0F167294C28495756FF|lonB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28210 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTGGTCCCTCCTGAAA, downstream forward: _UP4_TAAACCCTATTTTGATAATA
  • References

    Reviews

  • 23479438
  • Original publications

  • 16497325,11325926,9852015,18689473